منتدى أطفال الخليج ذوي الاحتياجات الخاصة

منتدى أطفال الخليج ذوي الاحتياجات الخاصة (http://www.gulfkids.com/vb/index.php)
-   العوق الحركي (http://www.gulfkids.com/vb/forumdisplay.php?f=6)
-   -   Spastin، البروتين تحور في مرض وراثي جسمي الشلل النصفي التشنجي وراثي، وتشارك في ديناميات أنيبيب (http://www.gulfkids.com/vb/showthread.php?t=16671)

رافت ابراهيم 11-22-2015 07:52 PM

Spastin، البروتين تحور في مرض وراثي جسمي الشلل النصفي التشنجي وراثي، وتشارك في ديناميات أنيبيب
 


http://hmg.oxfordjournals.org/content/11/2/153.full



يتميز راثي الشلل النصفي التشنجي (HSP) من خلال الضعف التدريجي والتشنج في الأطراف السفلية، والناجمة عن تدهور محدد من مساحات القشري، وهي أطول المحاور في البشر. معظم حالات شكل جسمية مهيمنة من المرض هي نتيجة لطفرات في الجين SPG4، الذي يشفر spastin، وهو أتباز عائلة AAA. مسارات الخلوية التي تعمل spastin ودورها في التسبب في تدهور المحاور الحركية غير معروفة حاليا. بالإعراب عن النوع البري أو أتباز معيب spastin في العديد من أنواع الخلايا، وتبين لنا الآن أن spastin تتفاعل بشكل حيوي مع الأنابيب الدقيقة. تم بوساطة جمعية Spastin مع الهيكل الخلوي أنيبيب من المنطقة N-محطة من البروتين، وينظم من خلال النشاط أتباز المجال AAA. التعبير عن كل الطفرات مغلطة في المجال AAA، التي تم تحديدها سابقا في المرضى، ويؤدي الى التأسيسي ملزم لميكروتثبول في الخلايا المصابة بالعدوى بالنقل والحث على اختفاء أستر وتشكيل حزم محيط بالنواة سميكة، مما يشير إلى دور spastin في ديناميات أنيبيب . باستمرار، من النوع البري spastin يعزز التفكيك أنيبيب في الخلايا المصابة بالعدوى بالنقل. وتشير هذه البيانات قد يكون متورطا أن spastin في ديناميات أنيبيب على غرار katanin البروتين، و-قطع أنيبيب مثلي للغاية. ضعف التنظيم جيد من الهيكل الخلوي أنيبيب في محاور طويلة، ويرجع ذلك إلى حدوث طفرات spastin، قد تكمن وراء التسبب في HSP.
القسم السابق القسم التالي
تلقى 18 سبتمبر 2001. المنقحة والمقبولة 16 نوفمبر 2001.

مقدمة

الشلل النصفي التشنجي وراثي (HSP) ويضم مجموعة غير متجانسة وراثيا من الأمراض الوراثية، التي تتسم بالضعف والشلل التشنجي في الأطراف السفلية (1، 2). قد يكون الشلل النصفي التشنجي ميزة معزولة (HSP النقي)، أو تكون مصحوبة أعراض عصبية إضافية (معقدة HSP). المتعلقات عصبية مرضية من هذه الصورة السريرية هو انحطاط الوراء التدريجي من المحاور القشري، وهي أطول المحاور في جسم الإنسان (3، 4). على الرغم من أن العديد من الجينات HSP تم تعيينها، واستنسخت سوى عدد قليل منهم حتى الآن. تم العثور على هذه الجينات أن تشارك في التنمية محور عصبي القشري (L1CAM) (5)، في الدبقية إلى الخلايا العصبية الإنذار (حزب العمال التقدمي) (6)، وظيفة الميتوكوندريا (paraplegin) (7)، مشيرا إلى أن الآليات التي يمكن أن تسهم في انحطاط المحاور الحركية والمتعددة (للمراجعة رؤية 8).
التسبب في الشكل الأكثر شيوعا من راثي الشلل النصفي التشنجي السائد لا يزال غير معروف تماما. ومن المقرر أن الطفرات في الجين SPG4، التي تقوم بتعيين إلى الكروموسوم 2p21-P22 (هذا النموذج 10) ويشفر بروتين الحمض الأميني 616، واسمه spastin (11). وعلى غرار paraplegin، spastin ينتمي إلى AAA (ATPases المرتبطة بمختلف الأنشطة الخلوية) أسرة، والتي تتميز مجال الحفظ من 230 الأحماض الأمينية مع النشاط أتباز (12). وأفادت عدة ورقات الطيف من الطفرات SPG4 في المرضى الذين يعانون HSP (+13 - +18). وفقا لهذه الدراسات، تمثل الطفرات SPG4 لا يقل عن 40٪ من جميع الأسر HSP المهيمنة مقهورة. وقد تمت مشاهدتها جميعا مغلطة، هراء ولصق موقع الطفرات وكذلك الحذف أو الإدراج في الجين spastin. والجدير بالذكر أن تسقط جميع الطفرات مغلطة في المجال AAA، باستثناء استبدال S44L الذي يظهر أن المرض تسبب فقط في الدولة متماثلة اللواقح (14)، الكامنة وراء أهمية وظيفية لهذا المجال. وتنتشر الطفرات الأخرى على طول المنطقة ترميز الجين ويؤدي إلى كودونات إنهاء سابقة لأوانها، ومرنا عدم الاستقرار، مما يوحي بأن haploinsufficiency هو السبب الجزيئي للأمراض (18).
وتشارك البروتينات AAA في طائفة واسعة من العمليات الخلوية، مثل دورة الخلية والنقل الحويصلي، وظيفة الميتوكوندريا، بيروكسية نشوء حيوي والتحلل البروتيني (19 - +21). على أساس التماثل تسلسل وتحليل النشوء والتطور، spastin ينتمي إلى فصيلة-7 (12) أو مجموعة الانتصافي (22) من البروتينات AAA. البروتينات أفضل وصف لهذه المجموعة الفرعية، katanin P60 وVps4 / SKD1، وتورط في العمليات الخلوية متباينة تماما، مثل انقطاع أنيبيب (23، 24) وendosomal التشكل والاتجار (25، 26)، مما يعوق التنبؤ ظيفة spastin بناء على homologies. على الرغم من أن برامج الكمبيوتر تتنبأ إشارة استيراد النووية (11)، توطين التحت خلوية spastin لا يزال غير معروف، وليس لدينا أي فكرة عن الآلية التي يمكن أن تؤدي الطفرات spastin إلى انحطاط المحاور القشري.
نحن الآن البيانات الحالية تشير إلى أن spastin تتفاعل مع الأنابيب الدقيقة عبر المنطقة-N محطة لها، وأن هذه الجمعية تنظم من خلال النشاط أتباز المجال AAA. وعلاوة على ذلك، نحن نقدم الأدلة الأولية تشير إلى أن مثل katanin، يمكن أن تشارك spastin في بعض جوانب أنيبيب التفكيك. وأخيرا، وتبين لنا أن كل الطفرات مغلطة spastin تقع في نطاق AAA، التي سبق تحديدها في المرضى الذين يعانون HSP، ربط جوهري على الأنابيب الدقيقة ويؤدي إلى إعادة توزيع الهيكل الخلوي أنيبيب. وتشير هذه البيانات إلى أن HSP بسبب SPG4 الطفرات قد تعتمد على وجود ضعف ديناميات أنيبيب في محاور طويلة.

النتائج

الزميلة spastin أتباز معيبة مع ميكروتثبول

من أجل الحصول على فكرة عن الدور البيولوجي للspastin، ونحن التحقيق توزيعه التحت خلوية عليها بنقل عابر مختلف بنيات spastin الموسومة حاتمة في كوس-7 الخلايا (الشكل 1). وأظهرت التجارب مناعي بعد تجزيء التحت خلوية عصابة من الحجم المتوقع (68 كيلو دالتون) في جزء حشوية (الشكل 2). وأظهرت دراسات المناعي أن spastin يموضع إلى هياكل منقط المنفصلة، ​​والتي تعرض توزيع محيط بالنواة (الشكل 3 A). تميل هذه الهياكل لزيادة الحجم مع فترة أطول من التعبير وملء نهاية المطاف السيتوبلازم. تجارب المناعي مزدوجة استبعد احتمال أن هذه المقصورات قد تتوافق مع العضيات المعروفة، مثل الميتوكوندريا، peroxisomes، في وقت مبكر والإندوسومات في وقت متأخر أو الجسيمات الحالة (لا تظهر البيانات). وقد لاحظنا نفس النمط من التعبير في أنواع الخلايا الأخرى مثل هيلا (الشكل 3 B)، U2OS وGN11، خط خلية العصبية ال اتش ار اتش. وعلاوة على ذلك، فإن استخدام المروجين مختلفة والحواتم (HA مقابل MYC أو GFP) إما المتمركزة على N- أو C-المحطة لن تتغير توطين spastin.
http://hmg.oxfordjournals.org/conten...3/F1.small.gif
الشكل 1. تمثيل تخطيطي للبنيات spastin المستخدمة في هذه الدراسة. يشار إلى المجال AAA من قبل الشريط الرمادي. يتم عرض موقف N-المحطة أو C-محطة من علامات مختلفة. الأرقام للدلالة على بقايا الحالية في بداية ونهاية كل بناء والمجال AAA.

http://hmg.oxfordjournals.org/conten...3/F2.small.gif
الشكل 2. تجزئة التحت خلوية تشير إلى أن spastin لديها توطين حشوية. و transfected خلايا كوس-7 إما مع pMT21-MYC ناقلات فارغة أو مع بناء spastin-MYC. تم تجهيز ثمانية وأربعين ساعة عينات بعد ترنسفكأيشن لجعل حشوية (C)، والنووي (N) الكسر. وكان كل من الكسور ثم ركز بواسطة مناعي، تعرض لالكهربائي على هلام الأكريلاميد 10٪ تليها immunoblotting مع الأجسام المضادة 9E10.

http://hmg.oxfordjournals.org/conten...3/F3.small.gif
الشكل 3. التحليل المناعي للأعرب عابر من النوع البري spastin. يظهر Spastin-MYC على منقط توطين منفصلة حشوية سواء في كوس-7 (A) وخلايا هيلا (B) بعد 24 ساعة من التعبير. عندما تحققت مستويات منخفضة من التعبير (مواد وطرق)، spastin يموضع إلى منطقة محيط بالنواة منفصلة (C). التحليل المناعي مزدوج باستخدام spastin-GFP (إشارة خضراء) بناء وعلامات المناسبة (إشارة حمراء)، وكشف أن هذا مجال التعبير في القرب من جهاز جولجي (D)، إلى أستر أنيبيب (E)، والجسيم المركزي (F وG). في (G)، سهام تشير إلى centrosomes. استخدمت الاجسام المضادة ضد 58 كيلو دالتون البروتين جولجي، ألفا تويولين وGTU88 للكشف عن جهاز جولجي، الأنابيب الدقيقة والجسيم المركزي، على التوالي.

ثم أننا تصميم التجارب ترنسفكأيشن من أجل رصد توطين spastin في الخلايا التي هي مجرد بداية للتعبير عن بناء (مواد وطرق). في ظل هذه الظروف، مضان spastin معين المسمى واحد فقط منطقة محيط بالنواة (الشكل 3 C). يقع هذه المنطقة بالقرب من جهاز جولجي (الشكل 3 D)، ويتوافق مع مركز زهور النجمة أنيبيب، وفقا لتقييم وضع العلامات مزدوج مع المضادة للα تويولين الأضداد (الشكل 3 E). هذا مجال التعبير على مقربة من الجسيم المركزي التي كشفت عنها-γ تويولين تلطيخ (الشكل 3 F و G). وتشير هذه البيانات إلى أن بداية التعبير spastin قد تكون في مركز تنظيم أنيبيب وذلك على فترات أطول من التعبير، spastin قد تتراكم في المجاميع حشوية.
أعضاء آخرين من الأسرة AAA، مثل SKD1، katanin P60 وربط جبهة الخلاص الوطني والافراج عن ركائز البروتين في الطريقة التي تعتمد على النوكليوتيدات (24، +27 - 29). هذا قد يؤدي إلى جمعية عابرة في الجسم الحي مع أهدافها. ومع ذلك، يمكن كشف هذه الجمعيات بالتعبير عن المسوخ المهيمنة سلبية غير قادرة على ربط أو يتحلل ATP. لاختبار ما إذا كان هذا صحيحا أيضا لspastin، ونحن overexpressed طفرة تتميز كذلك (K388R)، الذي يقع في وكر A عزر أو P حلقة المجال AAA، وكما هو معروف لإلغاء ATP ملزم في أعضاء آخرين في الأسرة (27 ، 28، 30). تم العثور على هذا المسخ في المريض مع HSP، وبالتالي يمثل شكلهما من spastin (13). عندما تم transfected spastin K388R في كوس-7 الخلايا، في التعبير البدء بها لوحظ في مجال محيط بالنواة واحد، على غرار البروتين من النوع البري (الشكل 4 A). ومع ذلك، مع فترات أطول من التعبير، وهو نمط الخيطية، تذكرنا بالتعاون مع الهيكل الخلوي تم الكشف عن (الشكل 4 B). في بعض الخلايا المصابة بالعدوى بالنقل لوحظ وجود مزيج من خيوط والمجاميع حشوية.
http://hmg.oxfordjournals.org/conten...3/F4.small.gif
الرقم 4. Spastin K388R يموضع إلى الأنابيب الدقيقة. في جميع الحالات وأعرب K388R spastin كما الانصهار GFP في كوس-7 الخلايا ومرئيا بمثابة إشارة خضراء. هي ملطخة النوى مع هويشت، إشارة الزرقاء. تم الكشف عن خيوط الأنابيب الدقيقة والمتوسطة باستخدام الأجسام المضادة وحيدة النسيلة ضد α تويولين وvimentin، على التوالي، إشارة حمراء. يشار شارك في التعريب بواسطة إشارة صفراء في الصورة المدمجة (A). يبدأ Spastin التعبير K388R في المراسلات من أستر أنيبيب (A) والعائدات مع تراكم في البنى الخيطية (B). هذه الشعيرات تتوافق مع مجموعة فرعية من الأنابيب الدقيقة (C و D) ولا يشارك في توطين مع vimentin (E و F). يتم تبديل توزيع أنيبيب في الخلايا المصابة بالعدوى بالنقل مع اختفاء أستر، وتشكيل حزم محيط بالنواة سميكة (D). أيضا، يتأثر توزيع خيوط المتوسطة (F). وأكد جمعية أنيبيب عن طريق العلاج نوكودازول، مما يعطل كل من نمط الخيطية التعبير عن spastin (G) وشبكة أنيبيب (H). في بعض الحالات، كانت محمية حزم أنيبيب المسمى spastin من تأثير نوكودازول [سهام في (G و H)]. أعطى تعبيرا عن spastin K388R بناء في خطوط الخلايا الأخرى نتائج متطابقة أساسا (لا تظهر البيانات).

من أجل تقييم طبيعة خيوط، كنا الاجسام المضادة ضد α تويولين وvimentin في التجارب المشارك التعريب، للكشف عن الأنابيب الدقيقة والشعيرات المتوسطة، على التوالي. بالإضافة إلى ذلك، كان يعمل تلطيخ falloidin للتحقيق في علاقة محتملة مع الأكتين. أظهرنا أن خيوط وصفت في K388R spastin خلايا -transfected شارك في توطين مع α تويولين (الشكل 4 C و D)، وليس مع vimentin (الشكل 4 E و F) أو الأكتين (لا تظهر البيانات). لمزيد من تأكيد ربط K388R spastin إلى الأنابيب الدقيقة، كررنا هذه التجارب بعد علاج الخلايا مع نوكودازول، وهو دواء قادرة على حمل أنيبيب التحلل عن طريق تثبيط إضافة أحادية تويولين. في جميع الحالات، كان نوكودازول فعال في الحصول على تشتت متحولة spastin وتويولين أحادية داخل السيتوبلازم في معظم الخلايا (الشكل 4 G و H).
شارك في توطين K388R spastin مع الأنابيب الدقيقة يظهر السمات الخاصة. أولا، على الرغم من كل خيوط وصفت من قبل spastin متحولة يبدو أن تشارك في توطين مع الأنابيب الدقيقة، وصفت ليس كل الأنابيب الدقيقة الموجودة في الخلية spastin (الشكل 4 C و D). وتشير هذه البيانات إلى أن متحولة قد ربط مجموعة فرعية من الأنابيب الدقيقة. ثانيا، يبدو توزيع أنيبيب في الخلايا المصابة بالعدوى بالنقل إلى تغييرها، مع اختفاء أستر وتشكيل حزم محيط بالنواة سميكة وطويلة (الشكل 4 C و D). وتمشيا مع إعادة توزيع الأنابيب الدقيقة، تشتت خيوط المتوسطة ويبدو أيضا تتأثر في الخلايا المصابة بالعدوى بالنقل (الشكل 4 E و F). ثالثا، في بعض الحالات تظهر هذه الباقات لتكون أكثر مقاومة للعلاج نوكودازول، مما يوحي بأن spastin قد حمايتهم من التحلل (الشكل 4 H).

الزميلة Spastin مع الأنابيب الدقيقة عبر المنطقة-N محطة ل

نتائج هذا التعبير spastin يبدأ في وسط أنيبيب تنظيم وأن-أتباز خلل الزميلة متحولة مع الأنابيب الدقيقة في الجسم الحي دفعتنا للتحقيق في ما إذا كان spastin قد ربط الأنابيب الدقيقة استقرت التاكسول في المختبر. واستكملت مقتطفات من الخلايا transfected spastin مع التاكسول وطرد لميكروتثبول الرواسب والبروتينات المرتبطة بها. في هذه الظروف، وقد أثرى كامل طول spastin في جزء أنيبيب (الشكل 5 A). من أجل تعيين المفترض ملزم أنيبيب مجال، ونحن transfected اثنين من المسوخ الاصطناعية التي إما تم حذف المجال AAA (spastin Δ -AAA) أو الجزء N-محطة من spastin (spastin Δ -N) (الشكل 1). وتبين لنا أن spastin Δ -AAA الإبقاء على القدرة على المشاركة في الرواسب مع الأنابيب الدقيقة بلمرة في في المختبر فحص ملزمة، في حين خسر spastin Δ -N عليه (الشكل 5 A). تم الحصول على نفس النتائج في التجارب المناعي، حيث أظهر spastin Δ -AAA بناء نمط الخيطية التعبير عرضة للمعاملة نوكودازول (الشكل 5 B و C)، في حين عرضت spastin Δ -N تلطيخ حشوية منتشر (الشكل 5 D ). معا، وهذه البيانات تشير إلى أن spastin يتفاعل مع الأنابيب الدقيقة من خلال المنطقة-N محطة لها. التناقض بين البيانات التي تم الحصول عليها في المجراة في المختبر مع البرية من نوع spastin يمكن التوفيق على افتراض أن الربط الأنابيب الدقيقة هو عابر في الجسم الحي والتي ينظمها النشاط في المجال AAA. كل من حذف كامل نطاق AAA وطفرة مغلطة K388R تغيير قدرته على ربط ATP قادرون على إيقاع البروتين في حالة محددة أنيبيب. على العكس من ذلك، المجال AAA في حد ذاته غير قادر على ربط مع الأنابيب الدقيقة وتشكيل المجاميع.
http://hmg.oxfordjournals.org/conten...3/F5.small.gif
يتفاعل الشكل 5. Spastin مع الأنابيب الدقيقة عبر ل-N محطة. (A) ملزم أنيبيب الفحص. و transfected خلايا كوس-7 مع spastin-MYC، أو spastin Δ -AAA أو spastin بنيات Δ -N. كانت لست] (L) من الخلايا المصابة بالعدوى بالنقل إما لا تستكمل (- التاكسول) أو تكميل (+ التاكسول) مع 40 ميكرومتر التاكسول. بعد الترسيب على وسادة السكروز، طاف (S) وبيليه ويعاير (P) الكسور لspastin، spastin Δ -AAA، spastin Δ -N وكشف-α تويولين، وذلك باستخدام الأجسام المضادة المناسبة. عندما تستكمل لست] مع التاكسول، من أجل تحقيق الاستقرار الأنابيب الدقيقة بلمرة، تم الكشف عن كل من كامل طول البروتينات spastin وspastin Δ -AAA في بيليه مع الأنابيب الدقيقة بلمرة، في حين لا يزال spastin Δ -N في طاف. عن السيطرة، وعندما لا يتم التعامل مع العينات مع التاكسول، يتم الكشف عن البروتينات في جزء طاف بعد الترسيب. ويظهر التحليل المناعي من spastin Δ -AAA نمط الخيطية التعبير (B)، والتي تعطلت بسبب العلاج نوكودازول (C). على العكس من ذلك، يظهر بناء spastin Δ -N توطين حشوية منتشر (D)، مؤكدا أن spastin Δ -N بناء غير قادر على ربط الأنابيب الدقيقة سواء في المجراة في المختبر.

Spastin يفكك الأنابيب الدقيقة في الجسم الحي

القدرة Spastin لربط الأنابيب الدقيقة بطريقة تعتمد على ATP وتعديل توزيع أنيبيب والتشكل أدى بنا إلى افتراض أنه يمكن أن يكونوا متورطين في بعض جوانب ديناميات أنيبيب. آخر البروتين AAA من نفس فصيلة، P60 katanin، وقد تمت دراسة إلى حد كبير عن النشاط أنيبيب قطيعة إزاء الجسيم المركزي (23، 24، 31). لتقييم المفترض نشاط أنيبيب فك spastin في الجسم الحي، نحن العاملين مقايسة المستخدمة سابقا لقياس في الجسم الحي أنيبيب فك katanin ولها انواع معينة ايليجانس homolog MEI-1 (30، 32). في هذا الاختبار، يتم فحص الهيكل الخلوي أنيبيب المناعي لمكافحة تويولين في كوس-7 الخلايا معربا عن spastin-GFP وبالمقارنة مع خلايا untransfected المجاورة. عندما أعرب البرية من نوع spastin في كوس-7 الخلايا، لاحظنا انخفاض كبير في شدة تويولين المناعي في ~50٪ من الخلايا المصابة بالعدوى بالنقل (الجدول الشكل 6 A، B، D و E). وقد لوحظ انخفاض كثافة تويولين تلطيخ أبدا في الخلايا المصابة بالعدوى بالنقل مع K388R متحولة spastin أو مع GFP وحده. وعلاوة على ذلك، وهذا التأثير هو محدد لالأنابيب الدقيقة، ولا يؤثر على شعيرات متوسطة. أظهر التعرض المفرط للخلايا transfected spastin أن الأنابيب الدقيقة يتم تقسيم، مع نهاية النهايات للخيوط التعرف في حالات قليلة (الشكل 6 C و F). خيوط المتبقية لا تزال تنبعث من جسيم مركزي، ولكن البعد عن أستر وتقلص إلى حد كبير (الشكل 6 C و F).
http://hmg.oxfordjournals.org/conten...3/F6.small.gif
الرقم 6. overexpression من النوع البري spastin يعزز أنيبيب التفكيك. في جميع الحالات وأعرب spastin لمدة 24 ساعة كما الانصهار GFP في كوس-7 الخلايا ومرئيا بمثابة إشارة خضراء. هي ملطخة النوى مع هويشت، إشارة الزرقاء. وكشف الأنابيب الدقيقة باستخدام الأجسام المضادة وحيدة النسيلة ضد α تويولين، إشارة حمراء. خلايا overexpressing spastin (A و D) تظهر كثافة أقل من-α تويولين تلطيخ (B و E) فيما يتعلق خلايا غير transfected. وعلاوة على ذلك، التعرض المفرط من الخلايا المصابة بالعدوى بالنقل في (B) و (E) يدل على أن الأنابيب الدقيقة وتفكيكها، ويبدو مجزأة (C و F والآراء مكبرة).


الجدول 1.
آثار overexpression من spastin من النوع البري على التفكيك microtuble

توصيف وظيفي من الطفرات مغلطة spastin لوحظت في مرضى HSP

حتى الآن، كل الطفرات مغلطة spastin وجدت في المرضى الذين يعانون HSP تقع في نطاق AAA. والاستثناء الوحيد هو سيرين لاستبدال يسين في موقف 44 التي تم الإبلاغ عنها تحدث في الدولة متماثل (14). لقد أظهرنا بالفعل أن الزميلة K388R متحولة مع الأنابيب الدقيقة. كخطوة أولى للتحقيق في دور وظيفي لجميع الطفرات مغلطة المحددة في المرضى HSP، ونحن ننظر في توطين لهم التحت خلوية. ولذلك أدخلت العديد من الطفرات مغلطة spastin وجدت في المرضى الذين يعانون HSP في ناقلات التعبير المناسبة، من خلال الطفرات موقع الموجه (الجدول 2). وبناء على المعارف المتاحة على أفراد آخرين من أسرته، AAA، وتوقع الطفرات مغلطة في المجال AAA للتدخل إما مع ATP ملزم أو التحلل.

الجدول 2.
توطين التحت خلوية من أعرب عابر الطفرات مغلطة spastin ذكرت في المرضى الذين يعانون HSP

وأظهرت كل المسوخ نمط الخيطية، وهو ما يعادل بالتعاون مع الأنابيب الدقيقة، كما يتبين بعد العلاج نوكودازول من الخلايا. ملزمة أظهر أنيبيب نفس الخصائص التي تم وصفها أعلاه لطفرة K388R، أي تشكيل حزم محيط بالنواة سميكة، واختفاء أستر، و، في بعض الحالات، وزيادة المقاومة للعلاج نوكودازول. وكانت وهما الاستثناء الوحيد لإحلال S44L، والطفرة S362C أن تصرف مثل البروتين من النوع البري. الطفرة الأولى تكمن خارج AAA، في حين أن الثانية يؤثر على الحمض الأميني فقط في بداية المجال.
البروتينات AAA أداء مهامهم في المجمعات هومو أو مغاير بلازميدة قليلة القسيمات. من أجل تحديد ما إذا كان المسوخ مغلطة spastin يمكن أن تكون بمثابة المهيمنة سلبية وتتداخل مع التعبير البرية من نوع spastin، شاركنا في transfected spastin K388R -GFP أو spastin L426V -GFP مع HA-spastin ونظرت إلى توطين التحت خلوية في مزدوج الخلايا المصابة بالعدوى بالنقل. وجدنا أنه في جميع الحالات من شارك في ترنسفكأيشن، من النوع البري وبروتينات متحولة دائما المشارك المعربة (الشكل 7). في بعض خلايا transfected شارك البرية من نوع البروتين المسمى الأنابيب الدقيقة (الشكل 7 E). في حالات أخرى، فإن كلا من المسخ والبرية من نوع spastin المترجمة إلى بقع حشوية (الشكل 7 A و B). قد يعكس هذا السلوك مختلفة أسعار مختلفة للتعبير عن المسوخ نسبة إلى البروتين من النوع البري. هذه النتيجة تتفق مع عمل spastin يجري الاعتماد على تشكيل oligomers، وتجارب أخرى ضرورية لتأكيد هذه الفرضية.
http://hmg.oxfordjournals.org/conten...3/F7.small.gif
الرقم 7. من النوع البري ومتحولة المجمعات شكل spastin في الخلايا المصابة بالعدوى بالنقل. إما spastin L426V -GFP (A) أو spastin K388R -GFP (D) كانوا زملاء مع transfected البرية من نوع HA-spastin في كوس-7 الخلايا. كل من البروتينات المتحورة مرئية كما إشارة خضراء. هي ملطخة النوى مع هويشت، إشارة الزرقاء. نزلت من النوع البري HA-spastin باستخدام وحيدة النسيلة المضادة للHA الأجسام المضادة، إشارة الحمراء (B و E). يشار شارك في التعريب بواسطة إشارة صفراء في الصور المدمجة (C و F). في بعض خلايا transfected المشترك، سواء متحولة والبرية من نوع spastin المترجمة إلى بقع حشوية (A-C). وفي حالات أخرى يتم دمج البروتين من النوع البري في البرية من نوع / heterodimers متحولة مما أدى إلى نمط الخيطية التعبير (D-F).

نقاش

الأنابيب الدقيقة هي البوليمرات ديناميكية للغاية من مفارز ألفا و-β تويولين، التي تقدم الدعم المعماري للخلايا حقيقية النواة، وتنظيم العضيات غشائي ويكون بمثابة السكك الحديدية على طول الذي يتم نقل مكونات حشوية. الأنابيب الدقيقة تخضع إعادة تنظيم السريع لتشكيلها خلال دورة الخلية، ويمكن تبديل فجأة بين استطالة وتقصير. وقد تم تحديد العديد من البروتينات التي تتحكم في التغيرات في الهيكل الخلوي أنيبيب في الجسم الحي (+32 - +35). نحن الآن البيانات الحالية تشير إلى أن spastin يمكن أن تشارك في ديناميات أنيبيب، وفتح آفاقا جديدة لفهم التسبب في HSP.
نجد أن الزميلة spastin مع الأنابيب الدقيقة في المختبر والتي تتوسط هذا التفاعل حسب المنطقة-N محطة لها. في الجسم الحي، ويمكن الكشف عن جمعية أنيبيب فقط بالإعراب عن المسوخ التي تفتقر إلى المجال AAA كامل أو عيب في ATP ملزم أو التحلل، مشيرا إلى أن الربط لميكروتثبول هو عابر وتنظيمها من خلال الدولة ملزمة النوكليوتيدات المجال AAA. أعضاء آخرين من الأسرة AAA تعرض oligomerization ATP التي تعتمد عابرة في وجود الركيزة البروتين، وعند التحلل ATP، الخضوع لتغيير متعلق بتكوين الذي يؤدي إلى الإفراج عن الركيزة (24، 27). وهكذا، على هذه البروتينات، ملزمة للأهداف البروتين هو عابر في الجسم الحي. P60 katanin يربط الأنابيب الدقيقة في المختبر ولكن لم يظهر أبدا لتسمية الأنابيب الدقيقة في الجسم الحي (24، 30، 36). وبالمثل، فقد وجد جمعية Vps4 / SKD1 إلى الأغشية endosomal في الخلايا المصابة بالعدوى بالنقل أن تعتمد على الدولة ملزمة النوكليوتيدات المجال AAA (25، 26).
عدة أسطر من الأدلة تشير إلى أن قد يكون متورطا spastin في تنظيم ديناميات أنيبيب. أولا، overexpression من النوع البري spastin في كل من كوس-7 و خلايا هيلا النتائج في النمط الظاهري-أنيبيب التفكيك. وقد لوحظ هذا النمط الظاهري أبدا في الخلايا المصابة بالعدوى بالنقل مع متحولة spastin أو مع ناقلات فارغة، وغير محددة لالأنابيب الدقيقة. ثانيا، overexpression من المسوخ spastin مما يؤدي إلى التأسيسي ملزم لالأنابيب الدقيقة يؤدي الى إعادة توزيع مجموعة أنيبيب، مع اختفاء أستر وتشكيل حزم محيط بالنواة سميكة، والتي كانت مقاومة للعلاج نوكودازول في بعض الحالات. قد تبقى الأنابيب الدقيقة المغلفة spastin طويلة وغير محله بسبب اضطراب ديناميتها بسبب البروتين متحولة. ثالثا، spastin هو غاية مثلي ضمن المجال AAA إلى katanin P60 وMEI-1، واثنين من حفز أنيبيب ATPases، والتي تتطلب المائي ATP لتفكيك الأنابيب الدقيقة (23، 24، 31، 32، 37). Katanin هو مغاير P60 / P80، وجدت في centrosomes وأقطاب المغزل الإنقسامية، ويعتقد أن يكون مسؤولا عن الإفراج عن الأنابيب الدقيقة من نقاط التعلق centrosomal بها (36، 38). A دورا مماثلا، وإن كان ذلك في الانقسام الاختزالي، وقد وصفت لمجمع MEI-1 / MEI-2 في C.elegans (32). كلا katanin P60 وMEI-1 تتطلب P80 WD-التي تحتوي على 40 البروتينات وMEI-2، على التوالي، في استهداف لcentrosomes وتحفيز النشاط قطع أنيبيب بها (23، 30، 32). على الرغم من أن المناطق N-الطرفية من spastin، P60 katanin وMEI-1 لا تحفظ بشكل علني، في جميع الحالات التي تم تعيينها مجال ملزم أنيبيب لهذه المنطقة. وبالمثل، البروتين استهداف أفضل درس عضوا الأسرة AAA، NSF، ينطوي-N محطة المجال الخاص به (39).
على الرغم من spastin يمكن أن تشترك الخصائص الفنية مع البروتينات قطع أنيبيب المعروف أن هناك عدة قضايا لا تزال بلا حل. لم نتمكن من تحديد ما إذا كان spastin يربط الأنابيب الدقيقة في centrosomes أو طول امتدادها في الجسم الحي، وإذا كان هذا التفاعل المباشر أو بوساطة بالتعاون مع بروتين آخر. على الرغم من transfections نفذت من أجل تحقيق مستويات منخفضة جدا من التعبير يوحي التعريب ممكن من spastin في مركز تنظيم أنيبيب، ينبغي تفسير هذه البيانات بحذر والدراسات مع الاجسام المضادة المحددة للكشف سوف تكون هناك حاجة إلى البروتين الذاتية. إذا ملزمة لميكروتثبول يحدث أيضا خارج الجسيم المركزي، يبدو أن يقتصر على أية حال لمجموعة فرعية منها، مشيرا إلى أن هذه الجمعية هي دينامية وربما ترتبط إلى إعادة تشكيل الهيكل الخلوي. وأخيرا، يمكن أن النمط الظاهري-أنيبيب التفكيك الناجمة عن overexpression spastin في الخلايا المصابة بالعدوى بالنقل يستمد إما من تعزيز الكارثة التي تقلص من الأنابيب الدقيقة من غاياتهم أو عن طريق توليد فواصل الداخلية داخل خيوط مع آلية فك الحقيقية. تجاربنا لا تسمح للتمييز بين هذين الاحتمالين وقطع أنيبيب في فحوصات المختبر باستخدام بروتين spastin المنقى المؤتلف مطلوبة قبل احتساب spastin في عدد من البروتينات قطع أنيبيب المعروفة.
أظهرنا أن جميع الطفرات spastin مغلطة، التي تقع في المجال AAA، تصرفت كما المسوخ أتباز معيبة، تغيير قدرة spastin لتنظيم التفاعل مع هذا الهدف، وبالتالي تؤدي إلى التأسيسي ملزمة لالأنابيب الدقيقة. والاستثناء الوحيد هو استبدال S362C، والذي يقع في بداية الفورية المجال، مما يشير إلى أن هذه الطفرة لا تعطل وظيفة spastin مع آلية مختلفة. تجارب زملاء ترنسفكأيشن من النوع البري ومتحولة spastin تتفق مع كائن معقد تجميعها تحتوي على خليط من هذين الشكلين من البروتينات. إذا كان هذا هو الوضع الفسيولوجي أو ما إذا كان spastin هو جزء من مجمع مغاير بلازميدة قليلة القسيمات مع شريك آخر، على غرار katanin P60 وMEI-1، يحتاج إلى توضيح. وقد أظهرت دراسات سابقة من النمط الجيني-النمط الظاهري ارتباط أنه لا يوجد اختلاف في شدة الشلل النصفي التشنجي بين المرضى الذين يعانون من الطفرات مغلطة spastin وتلك الطفرات إيواء مما أدى إلى إنهاء البروتين من السابق لأوانه (13). كلما تم اختبار مستوى مرنا spastin في الأنسجة من المرضى الذين يعانون من هذا النوع الأخير من الطفرات، فقد وجد أن بانتظام انخفضت بشكل حاد. هذه النتائج تتفق مع عدم الاستقرار مرنا، ولقد اقترحت أن haploinsufficiency هو السبب الجزيئي للأمراض (18). ومع ذلك، بياناتنا تفتح إمكانية أن آلية إمراضي المهيمنة سلبية يمكن أن تشارك في المرضى الذين يعانون من الطفرات مغلطة spastin ويبرر دراسات أكثر تفصيلا لتقييم هذا الاحتمال.
Spastin هو بروتين أعرب على نطاق واسع (11)، ولكن النمط الظاهري المرض هو مقيد بشكل ملحوظ على محاور القشري. الأنابيب الدقيقة ضرورية لنمو محور عصبي والصيانة. النموذج الحالي بشأن الآلية التي يتم من خلالها إنشاء مجموعة أنيبيب من محور عصبي المتزايد هو أن الأنابيب الدقيقة والأنوية في centrosomes ومن ثم نقلها بنشاط على طول المحاور والتشعبات (40). وأظهرت التجارب التي تم microinjected الأجسام المضادة حجب الوظيفية ضد P60 katanin في الخلايا العصبية مثقف أن katanin دورا أساسيا للإفراج عن الأنابيب الدقيقة من الجسيم المركزي الخلايا العصبية، ولكن أيضا لتنظيم طولها بعد الإفراج عن (41). وأشارت هذه التجارب أنه في الخلايا العصبية، أنيبيب فك يمكن أن يحدث أيضا بعيدا عن الجسيم المركزي، كآلية للحفاظ على الأنابيب الدقيقة قصيرة بما فيه الكفاية ليتم نقلها بكفاءة إلى المحاور والتشعبات. ومن المغري إلى التكهن بأن spastin هو بروتين رواية تشارك في ديناميات أنيبيب في الخلايا العصبية. لائحة غرامة وظيفة spastin قد يكون حاسما في عمليات طويلة من العصبونات الحركية القشرية، حيث وجود نصف الجرعة العادية من البروتين يمكن أن يكون ضارا بالفعل.
في الختام، ونحن نقدم أدلة على أن spastin تشارك في ديناميات أنيبيب عن طريق الربط بشكل عابر إلى الأنابيب الدقيقة بطريقة تعتمد على أتباز وتعزيز التفكيك في الجسم الحي. على الرغم من أن الدراسات المستقبلية ستتناول إذا spastin هو البروتين قطع أنيبيب صحيح، تفتح هذه النتيجة آفاقا جديدة لفهم التسبب في HSP بسبب الطفرات spastin.

المواد والأساليب

جيل يبني spastin

وقد تضخمت المنطقة الترميز من كدنا] spastin بواسطة PCR باستخدام PFU I البلمرة (PROMEGA)، هيلا كدنا] كقالب والاشعال محددة مصممة على تسلسل المتاحة (11). ثم subcloned جزء مما أدى إلى إطار في ناقلات التعبير حقيقية النواة التالية: pMT21-MYC، pcDNA3-MYC-GFP وpcDNA3-HA. في التركيبات الناتجة عن ذلك، يتم وضع MYC وGFP به محطة C إلى المنطقة الترميز spastin، في حين أن العلامة HA-N هي محطة لها (الشكل 1).
وspastinΔ -AAA بناء (المقابلة لطفرة هراء C932G) تم إنشاؤه بواسطة PCR التضخيم مع الاشعال محددة، وذلك باستخدام PFU I كما البلمرة، وsubcloned في ناقلات pMT21-MYC. و-N بناء spastin Δ، تفتقر أول 241 الأحماض الأمينية من spastin، ولدت قبل هضم spastin-MYC بناء مع منظمة التعاون الاقتصادي RI- جمعية مهندسي البترول الأول، تليها Klenow I العلاج في درجة حرارة الغرفة لمدة 15 دقيقة، وربط المصير. وأعادت ATG بعد ربط المصير. في كل حالة، تم تحديد سلامة الحيوانات المستنسخة عن طريق التسلسل المباشر.

في المختبر الطفرات

لإدخال طفرات نقطة، S44L، S362C، G370R، F831C، N386K، K388R، L426V، C448Y، R460L، R499C وA556V، إلى كل من spastin-MYC و / أو spastin-mycGFP يبني، في المختبر تم إجراء الطفرات باستخدام Quickchange موقع الموجه الطفرات مجموعة (Stratagene)، وفقا لتعليمات الشركة الصانعة. وبعد ذلك أكدت وجود طفرة النقطة تسلسل الحمض النووي. استخدمت الاشعال التالية: S44L، 5'-GCCCCTCCGCCCGAGTTGCCGCATAAGCGGAAC-3؛ S362C، 5'-GTTATTCTTCCTTGTCTGAGGCCTGAG-3؛ G370R، 5'-CCTGAGTTGTTCACAAGGCTTAGAGCTCCTG-3؛ F831C، 5'-GGCTGTTACTCTGTGGTCCACCTGG-3؛ N386K، 5'-GTCCACCTGGGAAGGGGAAGACAATGC-3؛ K388R، 5'-CTGGGAATGGGAGGACAATGCTGGC-3؛ L426V، 5'-GAAATTGGTGAGGGCTGTTTTTGCTGTGGCTCG-3؛ C448Y، 5'-GTTGATAGCCTTTTGTATGAAAGAAGAGAAGGG-3؛ R460L، 5'-GCACGATGCTAGTAGACTCCTAAAAACTGAATTTC-3؛ R499C، 5'-GGCTGTTCTCAGGTGTTTCATCAAACG-3؛ A556V، 5'-GCTTTGGCAAAAGATGTAGCACTGGGTCCTATC-3 ".

خطوط الخلايا والأجسام المضادة

قرد الكلى كوس-7 الخلايا، خلايا هيلا، GN11 (42) (يرجى التي تقدمها R.Maggi، ميلان) كان المثقف في المتوسط ​​تعديل النسر Dulbecco ولل(DMEM؛ Highclone) تستكمل مع المصل 10٪ بقري جنيني (Highclone). وأنتج وحيدة النسيلة الأجسام المضادة لمكافحة MYC من 9E10 خلايا هجين (43). تم شراؤها وحيدة النسيلة المضادة للHA الضد من بابكو، وحيدة النسيلة المضادة للα تويولين (1: 250) من المسابر الجزيئية. كان من سيجما: ومكافحة 58K البروتين (100 1)، مضادة للγ تويولين (01:50 GTU88). تم الحصول على جميع الأجسام المضادة الثانوية للالمناعي من داكو، في حين أن الفجل البيروكسيديز (HRP) الأجسام المضادة -conjugated من أمرشام.

ترنسفكأيشن الخلية والمناعي

و transfected كل بنيات باستخدام lipofectamine وفقا للتعليمات التي قدمتها الشركة المصنعة (لايف تكنولوجيز). Transfections للحصول أجريت على مستوى منخفض التعبير التي يحتضنها الخلايا التي تحتوي على خليط-DNA lipofectamine لمدة 4 ساعات وتحديد الخلايا في وقت لاحق 2 ساعة. وقد نمت الخلايا إما coverslips على أو على chamberslides multiwell (نونك) في DMEM، و 10٪ FBS، transfected كما هو موضح، وثابتة في بارافورمالدهيد 4٪ / برنامج تلفزيوني في درجة حرارة الغرفة. ل-γ تويولين المناعي، تم إصلاح الخلايا في الميثانول بنسبة 100٪ في -20 درجة مئوية لمدة 15 دقيقة. بعد التثبيت، تم permeabilized الخلايا في 0.2٪ تريتون X-100 / PBS لمدة 10 دقيقة، ومنعت في 10٪ مصل الخنازير لمدة 30 دقيقة. بعد حظر، وحضنت الخلايا التي تحتوي على الأجسام المضادة الأولية لمدة 2 ساعة والأجسام المضادة الثانوية المناسبة (1: 100) لمدة 1 ساعة. للكشف نوى، كانت ملطخة الخلايا باستخدام وصمة عار DNA محددة هويشت (سيغما). عند الطلب، تم علاج الخلايا مع 20 ميكرومتر نوكودازول (Calbiochem) لمدة 2.5 ساعة عند 37 ° C. وقد شنت الخلايا مع Vectashield (داكو) وفحصها تحت المجهر Axioplan (زايس) مجهزة مع كاميرا CCD Axiocam وAxiovision برامج التصوير الرقمي (زايس). ثم تم معالجة الصور باستخدام فوتوشوب 5.5 برنامج (أدوبي).

التفكيك أنيبيب في transfected كوس-7 خلايا

و transfected الخلايا مع spastin-GFP، spastin K388R -GFP، أو pcDNA3-GFP، الثابتة 24 ساعة بعد ترنسفكأيشن وتحليلها بواسطة المناعي مزدوج باستخدام مضان GFP وحيدة النسيلة ضد α تويولين. تم تنفيذ ثلاثة على الأقل تجارب ترنسفكأيشن مستقلة لكل بناء. لكل تجربة، تم فحص 100 الخلايا المصابة بالعدوى بالنقل لتقييم شدة مكافحة α تويولين تلطيخ. سجلنا خلية وجود النمط الظاهري-أنيبيب التفكيك فقط عندما كان موضع تقدير انخفاض هائل في تويولين مضان مقارنة مع الخلايا untransfected المجاورة. لتحليل سلامة الأنابيب الدقيقة في الخلايا مما يدل على انخفاض هائل في شدة-α تويولين تلطيخ، تم الحصول على صور مع وقتا أطول من التعرض.

تجزيء التحت خلوية ومناعي

وقد تم جمع الخلايا المصابة بالعدوى بالنقل 48 ساعة بعد ترنسفكأيشن، معلق في المخزن A (10 ملي HEPES الرقم الهيدروجيني 7.9، 1.5 ملي MgCl 2، 10 ملي بوكل، 0.5 ملي DTT، 0.5 ملي PMSF)، حضنت على الجليد لمدة 10 دقيقة والمتجانس. تم طرد العينات في 510 غ لمدة 10 دقيقة في 4 درجات مئوية، وجمعت طاف وتخزينها ككسر حشوية. وكان بيليه معلق الناتجة في المخزن B (20 ملي HEPES الرقم الهيدروجيني 7.9، 1.5 ملي MgCl 2، 0.42 M كلوريد الصوديوم، و 25٪ الجلسرين، 0.2 ملي EDTA، 0.5 ملي DTT، 0.5 ملي PMSF)، المتجانس وحضنت على الجليد لمدة 30 دقيقة. وبعد ذلك طرد العينة في 12 900 جم لمدة 30 دقيقة في 4 درجات مئوية وتحليل طاف ككسر النووي. سواء كانت تتركز الكسور النووية وحشوية بواسطة مناعي للبروتين الأجسام المضادة 9E10. كانت مجزأة عينات من مناعي على 8٪ هلام SDS-بولكرلميد، نشف على الغشاء PVDF والتي كشفت عنها تحليل طخة مناعية.

فحص ملزم أنيبيب

وقد تم جمع الخلايا المصابة بالعدوى بالنقل 48 ساعة بعد ترنسفكأيشن و lysed في بيم-DNNA العازلة (80 ملي أنابيب الرقم الهيدروجيني 6.8، 1 ملم EGTA، 1 ملم MgCl 2، 0.5 ملي DTT و 150 ملي كلوريد الصوديوم، 1٪ NP-40) تستكمل مع مثبطات الأنزيم البروتيني في 4 درجة مئوية لمدة 1 ساعة. تم طرد لست] في 610 غ لمدة 10 دقيقة على 4 درجات مئوية. والعصارة الخلوية ثم تنقيته بواسطة centrifugations على التوالي في 000 10 غرام لمدة 10 دقيقة، في 21 000 جم لمدة 20 دقيقة، وعند 100 000 ز لمدة 1 ساعة على 4 درجات مئوية. بعد ذلك تستكمل كل طاف مع 1 ملم GTP (Boeringher) و 40 ميكرومتر التاكسول (المسابر الجزيئية) وحضنت عند 37 درجة مئوية لمدة 30 دقيقة. كما أعدت عينات المقابلة دون التاكسول. والطبقات كل عينة على وسادة السكروز 15٪ وطرد في 30 000 جم لمدة 30 دقيقة في 30 ° C إلى الرواسب الأنابيب الدقيقة بلمرة. تم حفظ supernatants الناتجة عنها، وكان معلق الكريات في حجم مساو من عينة العازلة 1 × لالكهربائي وتحليل طخة مناعية.

رافت ابراهيم 11-22-2015 07:57 PM

وراثي خزل سفلي تشنجي: استعراض التطورات الجديدة
 
http://www.gulfkids.com/vb/newreply....uote=1&p=29562

+ الكاتب الانتماءات
  • قسم علم الأعصاب، وارد 11، رويال فيكتوريا المستوصف، نيوكاسل أبون تاين NE1 4LP، المملكة المتحدة، ب قسم علم الوراثة البشرية، ج قسم علم الأعصاب، مستشفى مانشيستر الملكي ومانشستر في المملكة المتحدة
  • الدكتور CJ ماكديرموت chrismcder {في} aol.com
  • تلقى 31 أغسطس 1999
  • قبلت 3 ديسمبر 1999
خزل سفلي تشنجي وراثي (HSP) أو متلازمة شترومبل-لورين هو الاسم الذي يطلق على مجموعة غير متجانسة من الاضطرابات الوراثية التي الميزة السريرية الرئيسية هي التدريجي أقل التشنج أطرافهم. قبل مجيء الدراسات الجينية الجزيئية في هذه الاضطرابات، كانت قد اقترحت عدة تصنيفات، استنادا إلى الوضع في الميراث، سن ظهور الأعراض، ووجود أو غير ذلك من الميزات سريرية إضافية. وقد وصفت العائلات مع جسمية مهيمنة، راثي متنحي، والوراثة المرتبطة X.
الجوانب التاريخية

في عام 1880 نشرت شترومبل ما يعتبر أول وصف واضح للHSP. وأفاد أسرة التي تأثرت شقيقين من قبل الشلل النصفي التشنجي. وقال الأب أن يكون "عرجاء قليلا"، مما يشير إلى جسمية نقل المهيمن. 1 كل شترومبل وورين أضاف الحالات المماثلة للأدب في السنوات اللاحقة. 2 3 بعد وقت قصير من هذه الأوصاف التاريخي، ظهرت العديد من الحالات المبلغ عنها من HSP في الأدب. ومع ذلك، وصفت برات، الذي كان يعتبر وجود ملامح العصبية إضافية لتكون متوافقة مع الوصف الأصلي، والعديد من هذه كما HSP بالإضافة إلى متلازمات. 4 التعليقات في وقت مبكر من هذه الحالات وغيرها محاولة لتحديد الحالات "النقية"، كما وصفت من قبل شترومبل . ومع ذلك، فإن تعريف "نقية" تنوعت بين المؤلفين. 5-8 وكان هاردينغ في عام 1981 الذي، بعد التقييم السريري مفصل من 22 عائلة، اقترح معايير لتصنيف HSP إلى أشكال نقية والمعقدة التي اعتمدت منذ ذلك الحين وتناقش أدناه. 9 واقترح كذلك تقسيم النقي HSP أيضا هاردينغ على أساس سن بداية المرض. وقد تبين أن الأسر يمكن فصلها إلى مجموعتين، واحدة مع بداية قبل 35 عاما (النوع الأول) والآخر مع بداية بعد 35 عاما (النوع الثاني). يبدو أن الاختلافات السريرية بين المجموعات، مع نوع هناك والمرضى الذين يعانون من دورة بطيء ومتغير مقارنة مع نوع المتطورة بسرعة أكبر II، والذي ضعف العضلات، والأعراض البولية، وفقدان الحواس كانت أكثر وضوحا. 9 أيا من هذه التصنيفات هي المثل الأعلى، مع العديد من الأسر ليس من السهل تركيب المعايير. كما هو الحال في غيرها من اضطرابات الاعصاب وراثية، فإن تفكك الآليات الوراثية الجزيئية الكامنة وراء خزل سفلي تشنجي وراثي توفر بلا شك تصنيف أكثر فائدة وذات الصلة.

علم الأوبئة

انتشار HSP يختلف في الدراسات المختلفة. هذا الاختلاف هو على الارجح بسبب مزيج من اختلاف معايير التشخيص، منهجية الوبائية المتغيرة، والعوامل الجغرافية. وجدت بعض الدراسات التي تم توظيف معايير وأساليب مشابهة لprevalance من HSP / 100 000 إلى 2.7 في موليز إيطاليا، و 4.3 في ادي أوستا إيطاليا، و 2.0 في البرتغال. 10-12 هذه الدراسات استخدمت معايير التشخيص التي اقترحتها هاردينغ وتستخدم جميع المؤسسات الصحية ومختلف العاملين في مجال الرعاية الصحية في حالات التأكد من منطقة محددة. لعبة البولو وآخرون في عام 1991 سجلت أعلى معدل انتشار 9.6 / 100 000 في كانتابريا، إسبانيا. 13 في تقريرهم فقط تم استخدام سجلات المستشفيات للتأكد من الحالات، على الرغم من أن تم تحديد العديد من الحالات الثانوية عن طريق فحص جميع أقارب في خطر.

المظاهر السريرية

PURE خزل سفلي تشنجي وراثية

يتم تضمين المعايير التي تم اقتراح لتشخيص النقي HSP في الجدول 1. معظم المرضى الحالي مع صعوبة في المشي أو اضطراب بالمشي، لاحظ إما من تلقاء نفسها أو أحد الأقارب. في تلك مع بداية مرحلة الطفولة، وهو تأخير في المشي ليس من غير المألوف. وتشمل الأعراض الأخرى تصلب الساقين، والاضطرابات البولية، وارتداء سابق لأوانه على الأحذية. ما يصل إلى 25٪ من المرضى المصابين هي أعراض، مع التأكيد على الطبيعة في كثير من الأحيان حميدة من المرض وأهمية التقييم السريري الدقيق للأسر المدرجة في الدراسات الجينية. سن بداية يمكن أن يكون من الطفولة إلى العقد الثامن. 9 وكان الاختلاف interfamilial ملحوظ في سن بداية واحدة من مؤشرات مبكرة لعدم التجانس الوراثي في هذه الحالة. قد يكون هذا الاختلاف يعود في جانب منه إلى صعوبة في التأكد من الموعد المحدد لبدء، لا سيما في المرضى كبار السن الذين لديهم هذا المرض لعدة عقود، أو قد تعكس آخرين حتى الآن غير معروفة عوامل التعديل وراثية أو بيئي.

الجدول 1
معايير التشخيص المقترحة لالنقي خزل سفلي تشنجي وراثي والسمات السريرية التي من شأنها أن تنبه الطبيب إلى التشخيص البديلة الممكنة

وتشمل تشوهات الكاردينال على فحص المرضى مع خالص HSP التشنج، فرط المنعكسات، وردود أخمصي الباسطة، مع ضعف التوزيع الهرمي في الأطراف السفلية. الجزء الأسفل من التشنج أطرافهم هو النتيجة بارز على الفحص، وخاصة في أوتار الركبة، الفخذ، والكاحلين. هذا النمط من فرط هو المسؤول عن مشية الكلاسيكية مع الشخص المصاب مما يدل ديرورة والقدمين المشي. ضعف العضلات عندما ينظر موجودة في العضلة القطنية، الظنبوبي الأمامي، وإلى حد أقل، وأوتار الركبة. هناك سمة من سمات HSP، والتي أكد من قبل العديد من الكتاب، هو التباين الشديد بين التشنج في كثير من الأحيان شديد وضعف العضلات معتدل فقط أو غائبة. 8 14 وهذا ما يتضح من المريض مع HSP الذي هو على كرسي متحرك ملزمة بسبب التشنج ولكن على اختبار العضلات اليدوي لديه قوة طبيعية.
الميزات الأخرى التي شملت بعض الكتاب تحت مظلة النقي HSP تشمل: تشوهات خفيفة الحسية في الأطراف السفلية، الهزات الكاحل غائبة، قدم جوفاء، والأعراض البولية، وترنح خفيف في الأطراف العلوية، وتلف العضلات البعيدة معتدل. +9 15-18 ويبدو أن هذا النهج أكثر شمولا ليتم التصديق عليها من قبل إصابات أجهزة متعددة اقترحه التحقيقات اسريرية والنتائج عصبية مرضية. ويعتبر حسي في 10٪ -65٪ من حالات النقي HSP ويوجد أكثر شيوعا، ولكن ليس على سبيل الحصر، في المرضى الذين يعانون من المرض منذ فترة طويلة. وهو يتألف عادة من شعور الاهتزاز تقلص وبشكل أقل في كثير من الأحيان، تضاءل الشعور موقف مشترك في الأطراف من الأطراف السفلية. 9 15 16 في معظم المرضى دراسات التوصيل العصبي طبيعية. 9 15 19 20 وهذا يشير إلى أن شذوذ وجدت في الفحص ومن المقرر إلى axonopathy المركزية بدلا من مشاركة الأعصاب الطرفية. هذا الاكتشاف النادر من الهزات الكاحل غائبة في المرضى الذين يعانون من HSP ربما يعكس نفس العملية. 9 16 قدم جوفاء ليس لتقصي شائعة مثل واقترح في الأصل. هاردينغ في مسلسلها جدت قدم جوفاء في الثلث فقط من المرضى. 9 قد يعكس وجودها شدة أو مدة المرض. يحدث البولية العاصرة اضطراب في ما يصل إلى 50٪ من المرضى. هذا يظهر عادة على أنها مزيج من الاستعجال، تردد، وتردد، وأكثر شيوعا في مرض منذ فترة طويلة. +9 15-17 21 22 مشاركة العضلة العاصرة الشرجية غير عادي في HSP، على الرغم من Schetlens آخرون فعلت الإبلاغ عن الأسرة التي كانت إلحاح البرازي وسلس البول وكان شوارتز الحالي، ووصف في وقت سابق من رجل أصاب بالمثل. في كلا التقريرين كانت الأعراض البولية موجودة أيضا. 23 24 فقط وقد تم وصف الخلل الوظيفي الجنسي في عائلة واحدة. وقعت حوالي 10-15 سنة بعد ظهور المرض، وهكذا لم تتأثر قدرة المريض الإنجابية بشكل كبير. المشكلة في الذكور المتضررة تتألف من فشل الانتصاب مع القدرة المحتجزة إلى القذف. 25 يتم الاعتراف تلف العضلات معتدل بشكل جيد على الرغم من غير المألوف في HSP. عندما تكون موجودة انها وجدت في العضلات البعيدة في الأطراف السفلية، وعادة عضلات صغيرة من القدم والظنبوبي الأمامي. وهو أكثر شيوعا في المرضى الذين لديهم المرض لأكثر من 10 عاما. 9 15 إذا تلف العضلات هو بارز وموجود في مسار المرض في وقت مبكر، ينبغي إعادة النظر في التشخيص. مشاركة الطرف العلوي غير شائع نسبيا ويتكون عادة من فرط المنعكسات معتدل، والتي قد تكون موجودة في مرحلة مبكرة من المرض. تتبع من خلل القياس محطة يمكن أيضا العثور عليها في الأطراف العلوية، ولكن لا ينظر إلى علامات المخيخ أكثر مزهر. هناك تقارير متفرقة عن ضمور العضلات البعيدة معتدل ولكن تورط أكثر وضوحا من الأطراف العلوية مع التشنج، والضعف، أو ضمور عضلي لا ينظر عادة في الخالص HSP. 9
النتائج سلبية مهمة على الفحص طبيعية وظيفة العصب القحفي وأي دليل على تورط الجهاز القشري. لم يدرس احتمال تورط الجهاز العصبي اللاإرادي في HSP بشكل منهجي، على الرغم من Cartlidge والعظام، عند الإبلاغ عن العثور على العضلة العاصرة اضطراب في المرضى الذين يعانون من HSP يعتبر تورط الجهاز العصبي اللاإرادي في ثلاثة مرضى وأداء البطارية وظيفة اللاإرادي الاختبارات التي كانت طبيعته. 17
التشخيص وشدة HSP يختلف بين الأسر، وإلى حد أقل، ضمن العائلة الواحدة، على الرغم من أن متوسط ​​العمر المتوقع أمر طبيعي. وقد دعمت العديد من الكتاب والمراقبة التي هاردينغ أنه في بداية مبكرة HSP (<35 عاما)، تطور المرض بطيء مع معظم المرضى المتبقي متنقل من خلال معظم حياتهم، ومع نسبة صغيرة فقط أصبح يقتصر على كرسي متحرك في الحياة المسنين. وهذا يتناقض مع العديد من المتأخر HSP (> 35 عاما)، ومنهم من تقدم المرض يمكن أن يكون سريعا، مع معظم المرضى يفقدون القدرة على المشي في 60S بهم و 70s الحالات. 9 16 20
خزل سفلي تشنجي وراثية معقدة

في حين أنه في الخالص HSP وخزل سفلي تشنجي هو سمة بارزة في التعقيد HSP هذا هو عنصر واحد من النمط الظاهري متغير أكثر من ذلك بكثير. بعض أنواع معقدة HSP نادرة للغاية، وربما فقط تم وصفها في عائلة واحدة. في بعض الحالات يمكن القول أن أكثر من اضطراب وراثي يمكن أن تسهم في المظاهر السريرية. ارتبط خزل سفلي تشنجي وراثي مع العديد من الشروط بما في ذلك ضمور العصب البصري، واعتلال الشبكية وأمراض خارج الهرمي، ضمور عضلي، والخرف، وترنح، والتخلف العقلي والصمم والسماك، والاعتلال العصبي المحيطي، والصرع. يتم إعطاء المراجع وصفا موجزا لالمظاهر السريرية الإضافية الواردة في الجدول 2.

الجدول 2
المظاهر السريرية التي يمكن أن ينظر إليها بالإضافة إلى خزل سفلي تشنجي في التعقيد خزل سفلي تشنجي وراثي

لم تذكر الصرع المرتبطة HSP في الاستعراضات السابقة، ربما لأنه مع فقط تقارير حالة نادرة من واحد أو اثنين من أفراد المتضررين في النسب، جمعية يمكن أن يكون من قبيل الصدفة، نظرا لارتفاع معدل انتشار الصرع في المجتمع. تقارير الحالات ولكن، على مدى العقد الماضي قد نشرت العديد من الكتاب حيث متلازمات الصرع وHSP يبدو أن يرتبط ارتباطا وثيقا. 39 41-44 تم العثور على أي نمط واضح بين الأسر التي توجد فيها هذه الجمعيات. كل من ينظر الميراث المهيمن ومقهورة. لا يوجد أي نوع الاستيلاء ثابت المرتبطة HSP والرمع العضلي والصرع الجزئي، معقدة جزئية، والمعمم بسيط تم الإبلاغ عنها. في بعض الأحيان وصفت أنواع مختلفة من المضبوطات في أعضاء المتضررين ضمن العائلة الواحدة. وبالمثل، هناك تفاوتا فيما يتعلق عندما تبدأ المضبوطات، مع أمثلة من المضبوطات التي سبقت واللاحقة لظهور بداية اضطراب المشية. وكثيرا ما وصفت تتعايش التخلف العقلي أو ضعف الادراك في هذه الأسر. الصرع هو سمة مميزة للأمراض الميتوكوندريا (على سبيل المثال، MERRF)، وهي مجموعة من الأمراض التي غالبا ما تتظاهر أعراض متنوعة لا تختلف معقدة HSP. كما سيتم مناقشته لاحقا، وقد تم العثور على أدلة عن تورط الميتوكوندريا في بعض جسمية الأسر HSP المتنحية، وسيكون من المثير للاهتمام أن تحديد ما إذا كان ضعف الميتوكوندريا يسهم في التسبب في أشكال أخرى من HSP.
هناك عائلات مع HSP الذين لا يبدو أن لديها تورط الأعصاب الطرفية. ذكرت شادي وسميث أسرة بمشاركة الحسي غير متناظرة الكشف على الفحص السريري. كل تلك داخل الأسرة الذين خضعوا لدراسات التوصيل العصبي قد انخفضت إمكانات العمل الحسية. خضع ثلاثة مرضى خزعة الأعصاب، والذي أظهر انخفاض أعداد الألياف مياليني الكبيرة والمتوسطة الحجم مع عدم وجود دليل على إزالة الميالين، مما يدل على الاعتلال العصبي المحاور. 50 وتمثل هذه الأسر أمثلة معقدة HSP. ووصفت تقارير سابقة الاعتلال العصبي الحسي الشديد بالتعاون مع HSP، مع تقرحات جلدية مؤلمة المزمنة والأعصاب ارتشاف العظام التي تحدث في مرحلة الطفولة المبكرة. 51 وفي شكل أقل حدة التغيرات الجلدية الغذائي وتقرحات في القدمين تتطور في حياة الكبار فرضه على المنشأة منذ مدة أطول تشنجي خزل سفلي. 52 53
ارتبط الخرف مع HSP في الأنساب حيث يجوز لأعضاء تظهر ميزات إضافية مثل ترنح، 65 التلفظ، 66 التلفظ والجمود الوجه المعتدل، 40 أمراض القلب، 32 الصرع، 39 وفي متلازمة الصاري الذي يتكون من الشلل النصفي التشنجي مع الخرف، التلفظ وكنع. 62 كما تم الإبلاغ عن الخرف في كل جسمي العائلات المهيمنة والمتنحية، كمرافقة معزولة لخزل سفلي تشنجي. 35-38 وفي هذه الأسر، تم العثور على أنماط مماثلة من العجز المعرفي. وتشمل هذه توليفات مختلفة من الذاكرة التالفة الأخيرة، وضعف الانتباه، وضعف سرعة الإدراك الحسي، وضعف التنسيق visuomotor، والنسيان. في أوصاف الأشخاص المتضررين كان هناك غياب للميزات يشير إلى تورط كبير القشرية مثل عسر، عمه، وخلل الحساب. وهو ما يوحي بأن الخرف تحت القشرية قد تميز النمط الظاهري HSP معقدة من الشلل النصفي التشنجي مع الخرف. فمن الممكن أن درجة أخف من الضعف الادراكي قد تكون أكثر شيوعا مما كان معروفا من قبل في متضررين من HSP. 38 ولم يتم بعد تقييم هذه المشكلة بشكل منهجي. في واحدة من عدد قليل من الدراسات التي قيمت بعناية الوظيفة الإدراكية، وقد تجلى ضعف اعرضي في خمسة من أصل سبعة مرضى من أربع عائلات مع خالص HSP. 67 ويبدو من المرجح، بالتالي، أنه إذا تم تقييمها بعناية المرضى لمشاكل في الادراك تحت الإكلينيكي، أنه حتى نقية سوف HSP تتحول إلى اضطراب أجهزة متعددة، بمشاركة خارج نظام المحرك. وقد تم الاعتراف بشكل متزايد هذه الظاهرة في الاضطرابات الحركية يبدو انتقائية الأخرى، بما في ذلك مرض العصبون الحركي. 68 69

النتائج على التحقيق

تحقيقات مفيدة في تشخيص باستثناء بديلة، ولكن لا خلاف ذلك إضافة إلى اليقين التشخيص HSP. تم الإبلاغ مرات التوصيل المحرك المركزي لعدد من المؤلفين لإظهار أي ردود unrecordable، أو تأخر من الأطراف السفلية، مع القيم عادة طبيعية من الأطراف العلوية. 70-73 أثارت الحسية الجسدية تم الإبلاغ الإمكانات إلى أن تكون صغيرة أو غائبا، مع شذوذ مرة أخرى ينظر أساسا في الأطراف السفلية. 20 72 74 دراسات التوصيل العصبي وEMG طبيعية في معظم الحالات من الذهب الخالص HSP. 9 20 73 75 76
تحليل السائل النخاعي عادة ما يكون غير ملحوظة في HSP. ومع ذلك، فقد تضمنت تقارير متفرقة عن شذوذ زيادة تركيزات البروتين في الأسر معقدة وأثار تركيزات هوموكارنوزين في عائلة معقدة مع الشلل النصفي التشنجي، القصور العقلي التدريجي، وتصبغ الشبكية. 18 29 77 78
على MRI قد تظهر في النخاع الشوكي صغير، ولكن لا ينظر إلى تشوهات أخرى عادة. هناك تقارير متفرقة من خفيفة الى معتدلة ضمور هياكل داخل الجمجمة، وخصوصا الجسم الثفني، وأيضا من آفات المادة البيضاء في نصفي الكرة المخية. 15 71 79 80 ومع ذلك، تميز ضمور أو تغييرات في المادة البيضاء على MRI تتطلب استبعاد شامل من الشروط الأخرى .
يتم إحراز تقدم سريع في علم الوراثة الجزيئية من HSP، والتي سوف تؤثر على الطريقة التي تحقق وتشخيص HSP في المستقبل، وهذا يتم مناقشتها في وقت لاحق.

التشخيص التفريقي

وينبغي النظر خزل سفلي تشنجي وراثية تشخيص الاستثناء. من المهم أن تنظر الاضطرابات التي يمكن علاجها التي يمكن أن تقدم بطريقة مماثلة، مثل نقص B12، دوبا خلل التوتر استجابة، واضطرابات الحبل الشوكي الهيكلية. كما ينبغي استبعاد الاضطرابات، والتكهن من الذي يختلف كثيرا عن HSP، مثل التصلب المتعدد ومرض العصبون الحركي العائلي. وضرورة إجراء تحقيقات تختلف اعتمادا على الصورة السريرية الفردية. الجدول 3 تفاصيل التحقيقات التي قد تكون مفيدة في استبعاد اضطرابات أخرى في المرضى الذين يعانون معين. مرة واحدة فقط يتم استبعاد التشخيصات الأخرى بثقة يمكن نصح المرضى وأسرهم بشكل مناسب.

الجدول 3
التشخيص التفريقي من خزل سفلي تشنجي وراثي

أمراض الأعصاب

خزل سفلي تشنجي وراثي هو مرض والذي يتوافق مع متوسط ​​عمر متوقع طبيعي، مع معظم المرضى يموتون في سن الشيخوخة من الأمراض من قبيل الصدفة. وبالنظر إلى الإزمان للحالة وندرة خيارات العلاج، ونسبة كبيرة من المرضى قد لا تكون قيد الاستعراض المنتظم من قبل طبيب أعصاب. ولذلك فإنه ليس من المستغرب أن هناك عدد قليل نسبيا من التقارير المرضية في HSP. استعرض شوارتز ولوي التقارير المرضية في وقت مبكر في عام 1952، وتحديد سبع حالات HSP نقية وأضاف وصف الخاصة بهم من الحالات في عام 1956. 81 24 فقط وقد تم نشر عدد قليل من التقارير المرضية منذ ذلك الحين. 80 82-84 ميزة عصبية مرضية الرئيسية من الذهب الخالص HSP هو انحطاط المحاور التي هي القصوى في الأجزاء الطرفية من أطول الهابطة (مساحات القشري) والصعود (مسارات العمود الظهري) مساحات داخل الحبل الشوكي. إزالة الميالين ودباق يمكن أن تصاحب فقدان محور عصبي. مسارات الأكثر تضررا هي مساحات القشري عبرت وامتصالب إلى الأطراف السفلية وfasiculus الناحلة الألياف من الأطراف السفلية (الشكل). ويعتبر إشراك مساحات مخيخي شوكي في حوالي 50٪ من الحالات. انخفضت غيرها من النتائج ذكرت أقل شيوعا وشملت عدد من خلايا بيتز في الطبقة الخامسة من القشرة الحركية في أربع حالات، تميزت فقدان الخلايا العصبية في العمود كلارك في أربع قضايا أخرى، وحالة واحدة في الذي أظهر المخيخ والعقد القاعدية فقدان الخلايا العصبية. 85 الظهرية العقد الجذرية والجذور الخلفية، والأعصاب الطرفية وعادة ما تكون طبيعية، وكذلك خلايا القرن الأمامي، على الرغم من أن تقرير واحد لم تثبت انحطاط خلايا القرن الأمامي في جميع أنحاء الحبل الشوكي من الشخص المتضرر. 24
http://jnnp.bmj.com/content/69/2/150/F1.medium.gif
Midcervical قسم الحبل الشوكي من حالة من كروموسوم 2 وراثي مرتبط بالجنس المهيمنة نقية HSP (SPG4)، ملطخة للالمايلين مع Luxol الأزرق سريع. هناك منتشر شحوب المايلين مساحات القشري عبرت وامتصالب. بالإضافة إلى ذلك، الحزم النواة الناحلة في وسط الأعمدة الظهرية تظهر شحوب المايلين بارز. خلايا القرن الأمامي طبيعية في عدد والتشكل.

في الدراسة الكمية فقط، تم العثور على حجم الأهرامات في الشخص المتضرر الذين تتراوح أعمارهم بين 57 إلى تكون قابلة للمقارنة مع حجم في المتوسط ​​2 سنة من العمر. وكان العدد الإجمالي من الألياف العصبية مياليني في الهرم 376 055 مقارنة مع 625 700 في رجل 20 سنة من العمر. في نفس الدراسة تم تخفيض عدد الخلايا بيتز إلى 23 652 في منطقة المحرك الأيسر مقارنة مع 34 562 في 22 سنة للنساء القديمة. طبيعة الضمور الخلوي غير مؤكدة. ويمكن تفسير الحد من خلايا بيتز من قبل انحطاط إلى الوراء، وهو ما يمكن ملاحظته عندما يحدث تلف في الحبل الشوكي عن طريق عدة آليات. وبالنظر إلى أن الجزء الأعلى من المحاور الطويلة في مساحات القشري، والممرات الحسية ومخيخي شوكي تتأثر بشكل تفضيلي في HSP، وقد اقترح أن عملية "الموت مرة أخرى" يحدث، مع انحطاط بدأت بشكل أقصى ومن ثم المضي نحو جسم الخلية . 24
وقد كشفت التقارير المرضية في بعض الأحيان مشاكل غير متوقعة سريريا مثل ظهري العمود انحطاط في المرضى دون تشوهات الحسية للكشف خلال الحياة. قد حالة واحدة موثقة المخيخ والقاعدية أمراض العقد في التشريح، دون أي مترابطة سريرية موثقة. 85
في الآونة الأخيرة، وقد وصفت التغيرات المرضية جديدة في قضية النقي HSP، مع راثي الميراث المهيمن، مرتبطة بموضع كروموسوم 2. كان المريض صفت التاريخ المبكر متوافق تماما مع خالص HSP وتطوير خزل سفلي تشنجي التدريجي من العمر 19 عاما. ومع ذلك، في سن 72 عاما طور dementing المرض التدريجي بسرعة مع عدة نوبات الصرع في المراحل مشارف للموت. كان علم الأمراض الحبل الشوكي تماما تمشيا مع خالص HSP. إلا أن أمراض الدماغ غير عادي. وتشمل الميزات المثيرة للاهتمام فقدان الخلايا العصبية في المادة السوداء مع الهيئات ليوي وشاحب المرتبطة بها، والتغيرات الحصين مع تاو مناعيا التشابك الليفي العصبي. وهناك سمة أخرى جديرة بالملاحظة وجود تاو الهيئات إدراج إيجابية في مجال الحوفي والقشرة المخية الحديثة. لم يسبق أثبتت هذه التغييرات في HSP، وكذلك لا تتوافق مع ما يميز أمراض أشكال أخرى محددة من الخرف. كان ذلك ممكنا، بالتالي، أن هذه الميزات المرضية الدماغية هي نتيجة مباشرة للتعبير عن الشاذ المنتج SPG4 الجينات. 40

علم الوراثة

يتم مطابقة التجانس السريري للHSP كتبها التجانس الوراثي. يتم التعرف على العائلات المهيمنة، المتنحية، وX المرتبطة مقهورة بشكل جيد مع عدة مواضع وصفها. يتم عرض ملخص للتصنيف الجيني الحالي للHSP في الجدول 4.

الجدول 4
التصنيف الجيني الحالي للخزل سفلي تشنجي وراثي

راثي HSP المهيمن (ADHSP)

ميراث السائد هو الأكثر شيوعا طريقة الميراث في HSP وارتبط إلى مواضع على الصبغي 2P (SPG4)، 38-40 71 86-94 كروموسوم 14Q (SPG3)، 88-90 95-97 كروموسوم 15q (SPG6)، 98 8Q كروموسوم (SPG8)، 99 chromosome10q (SPG9)، 64 وكروموسوم 12q (SPG10). 100
كروموسوم 2P LOCUS SPG4

موضع كروموسوم 2 (SPG4) هو إلى حد بعيد الأكثر شيوعا موضع التي ترتبط الأسر ADHSP، وهو ما يمثل حوالي 40٪ من الأنساب. مؤخرا تم التعرف على الجين المسؤول عن HSP في موضع SPG4 باستخدام استراتيجية استنساخ الموضعية. الجينات، spastin، ويقع على الكروموسوم 2p22-P21 ويتكون من 17 الإكسونات التي تغطي منطقة 90 كيلو بايت. 101 Spastin هو عضو في مجموعة من البروتينات المعروفة باسم ATPases المرتبطة بالأنشطة الخلوية المتنوعة (AAA). البروتينات AAA تعمل في مختلف الوظائف الخلوية، بما في ذلك تنظيم دورة الخلية، وتدهور البروتين، عضية نشوء حيوي، والحويصلة بوساطة وظيفة البروتين. 102 كل هذه الآليات الخلوية إشراك التجمع وظيفة البروتين المجمعات واقترحت أن أفراد الأسرة AAA تعمل كما البروتينات كوصي في هذه المجمعات. 103 البروتينات AAA تشترك في مجال الحمض الأميني الذي يضفي 230 وظيفة أتباز. خارج هذا النطاق يعتبر التماثل قليل جدا، إلا بين البروتينات ترتبط ارتباطا وثيقا من نفس البروتين AAA فصيلة. 102 ومن المثير للاهتمام paraplegin، عضو AAA البروتين فرعية أخرى، وقد تبين أن تشارك في SPG7 راثي متنحي HSP (انظر لاحقا). 104 سهم Spastin تناظر قليلا مع paraplegin بصرف النظر من داخل المجال AAA وعلى عكس paraplegin، ومن المتوقع أن يكون هناك توطين النووية. يظهر Spastin أكبر تناظر لفئة فرعية معينة من البروتينات AAA التي تشمل 26S الخميرة مفارز proteasome و. 101 وقد اقترحت البروتينات AAA النووية التي تظهر التماثل إلى 26S مفارز proteasome وتلعب دورا غير مباشر في تنظيم الجينات، الأمر الذي أدى تنشيط بروتين أو تدهور عوامل النسخ . 105
حتى الآن الطفرات spastin حددت تشمل مغلطة، هراء، والطفرات موقع لصق في مختلف الإكسونات مما يؤدي إلى تغييرات كبيرة في تسلسل الأحماض الأمينية في المجال AAA. هذا يشير إلى أن SPG4 يسببه فقدان وظيفة مما يعني أن مستوى عتبة spastin التعبير البروتين ضروري للحفاظ محور عصبي في الجهاز القشري. 101
على الرغم من أن معظم الأنساب SPG4 لها النقي HSP، كانت هناك ثلاث عائلات مع الظواهر معقدة ترتبط أيضا في هذا الموضع. 38-40 وفي الأسر HSP النقية مرتبطة بهذا الموضع وضعت هناك interfamilial والاختلاف داخل الأسرة في شدة وجود أو غياب ميزات مثل أعراض المثانة والشعور اهتزاز تقلص.
ليست كل الدراسات التي نشرت التعليق على شدة ضعف الحركية في الأشخاص المتضررين وتلك التي تفعل في كثير من الأحيان ليس من السهل للمقارنة مباشرة تقارير مختلفة. هناك يميل إلى أن يكون مجموعة من شدة مع غالبية المتضررين الإبقاء على القدرة على المشي بشكل مستقل أو مع الحد الأدنى من الدعم. في هذه الحالات هم المرضى الذين يعانون أعراض مع وجود علامات الهرمية في الأطراف السفلية مع طبيعية أو غير طبيعية فقط مشية قليلا وعدد قليل من المرضى الذين هم chairbound أو طريح الفراش. 71 94
هناك تفاوتا ملحوظا في سن ظهور الأعراض في كروموسوم 2P الأسر المرتبطة. عدة الأنساب نشرت تظهر في سن ظهور الأعراض تتراوح ما يزيد على 5 أو أكثر من الزمن في أعضاء مختلفة من نفس العائلة. متوسط ​​العمر عند ظهور الأعراض من الأنساب نشرت يتراوح 12-43 عاما، مما يدل على اختلاف interfamilial أيضا. سبب هذا interfamilial والاختلاف داخل الأسرة غير معروف. قد تمثل alleic عدم التجانس أو وجود تعديل جينات أو عوامل بيئي. قد تكون عامل آخر لصعوبة واضحة في الاعتراف التوقيت الدقيق لظهور الأعراض التي تبدأ دهاء، وكانت غالبا ما تكون موجودة لسنوات عديدة.
في بعض العائلات وذكرت تحسبا حيث سن في بداية النقصان في الأجيال اللاحقة. 40 71 89 92 هذا وينظر في الاعصاب الأمراض الأخرى، على سبيل المثال، مرض هنتنغتون، وضمور مسنني حمراوي-pallidoluysian (DRPLA)، ومرض ماتشادو يوسف (MJD) . ومع ذلك، تسبب هذه الأمراض عن طريق توسيع CAG تكرار غير طبيعي وهذا هو الزيادة في طول توسع تكرار الذي يرتبط مع بداية الأصغر من المرض في الأجيال اللاحقة. 106-108 قبل اكتشاف الجين spastin كانت هناك عمليات تفتيش واسعة ل دليل على أن SPG4 كان اضطراب ثلاثي النوكليوتيد تكرار. كلا الأدلة الوراثية السريرية والجزيئية ما إذا كان يكرر CAG توسيع كانت الممرضة في SPG4 كانت غير حاسمة. 109-111 ومع ذلك، لا تحتوي على الجين spastin تكرارا CAG توسعت بشكل غير طبيعي وتفسير بديل للتحسبا الظاهر ينظر في بعض العائلات SPG4 يجب التماس. هذا يمكن أن يكون ببساطة أنه عندما يقال الترقب، هذا قد تمثل في الواقع التحيز التثبت، التي يلاحظ المرض في وقت مبكر من الأطفال من الآباء المتضررين.
ومن المثير للاهتمام، في ثلاث عائلات كروموسوم 2P المرتبطة، وارتبط HSP مع ضعف الادراك. وصف ويب آخرون عائلة كبيرة مع 12 عضوا المتضررين. توفي أحد المرضى من dementing المرض تم العثور الذين تتراوح أعمارهم بين 62 و أربعة من أفراد أسرته مع HSP أن يكون الخرف من نوع تحت القشرية على التجارب العصبية. 38 في الأسرة الفرنسية، التي وصفها Heinzleff وآخرون، وكان أربعة من أصل سبعة أفراد الأسرة المتضررين الادراكي في حين كان واحدا الخرف الشديد مع بعض ميزات القشرية. وكان ثلاثة أعضاء المتضررين يعانون من ضعف الادراك أيضا الصرع. 39 في الأسرة التي أبلغ عنها وايت وآخرون، توفي عضو مؤشر HSP مع المتأخر dementing المرض شديد مع ميزات القشرية وخارج هرمية. كان اثنان من أفراد الأسرة الآخرين ضعف الذاكرة في الشيخوخة، على الرغم من أن معلومات مفصلة عن الأعراض الحركية في هؤلاء الأعضاء لم تكن متوفرة. وكان أحد أفراد الأسرة الآخرين مع HSP صعوبات التعلم الشريط الحدودي مع ضعف بسيط في جميع جوانب الذاكرة. كما في عائلات أخرى كانت هناك أفراد الأسرة مع HSP دون التغيرات المعرفية. وقد نوقشت النتائج المرضية في المرضى الذين يعانون من الخرف في هذه النسب في وقت سابق. 40
كروموسوم 14Q LOCUS SPG3

أول مكان ADHSP من يكتشفها كان SPG 3 على الصبغي 14Q، وقد تم ربط خمسة فقط الأسر التي نشرت في هذا الموضع. وقد ضاقت موقع الجين SPG3 على chromosome14q11.2-q24.3 إلى منطقة 7 سم. 88 90 95-97 ومن بين الأسر خمس هناك لا يبدو أن هناك اتجاها لسن مبكرة نسبيا في بداية المرض، مع متوسط ​​عادة في غضون العقد الأول أو الثاني. لم يكن هناك أي أدلة تشير إلى توقع العمر عند بداية في الأجيال المتعاقبة. في البداية كان يعتقد أن النمط الظاهري SPG 3 قد يكون أيضا أكثر شدة من أنواع فرعية أخرى من HSP. ومع ذلك، وهوانغ آخرون والأنساب Gispert قد نشرت آخرون فيها نسبة الحالات المصابة بشدة (تلك التي تتطلب كرسي متحرك) هي لا تختلف عن تلك التي شوهدت في بعض الأنساب SPG4 المرتبطة.
مقارنة مع مواضع أخرى، حيث تم ذكر ذلك، يبدو أن هناك غياب المثانة أو إشراك الحواس في النمط الظاهري SPG 3.
كروموسوم 15Q LOCUS SPG6

واحد فقط، كبيرة في أمريكا الشمالية، وقد تم ربط الأسرة SPG6. تم تعيين مكان لسم الفاصلة ~7.3 في منطقة القسيم المركزي من كروموسوم 15q. 98 وكان متوسط ​​العمر عند بداية 22 سنوات (12-35) وعلى العموم كان النمط الظاهري من الذهب الخالص HSP، على الرغم من أن النمط الظاهري شديد نسبيا . تقريبا ثلث أعضاء المتضررين مطلوبة على كرسي متحرك، وبعض في وقت مبكر من 40 عاما من العمر. وقدم جوفاء دائما تقريبا موجودة في أفراد المتضررين، وربما انعكاس لشدة المرض.
LOCUS كروموسوم 8Q (SPG8)

وقد تم ربط عائلتين إلى مكان SPG8 على الصبغي 8q24. عائلة واحدة كبيرة في أمريكا الشمالية، ومؤخرا عائلة بريطانية، والتي مكنت من مكان وراثي ليتم تكريره في منطقة 3.4CM. 99 112 متوسط ​​العمر عند ظهور الأعراض في SPG8 ترتبط الأنساب وقابلة للمقارنة مع الأسر SPG4. ويبدو أن النمط الظاهري لتكون شديدة إلى حد ما، وخاصة في الأسرة الأمريكية، التي 10/15 أعضاء المتضررين أكثر من 40 عاما يتطلب استخدام كرسي متحرك، ثمانية منهم لأكثر من 50٪ من الوقت. 113 وفي كلا الأنساب المظاهر السريرية كانت نموذجية من الذهب الخالص HSP مع بعض أفراد العائلة الذين لديهم نقص شعور الاهتزاز، وأعراض المثانة، وقدم جوفاء. أظهر التصوير بالرنين المغناطيسي ضمور النخاع الشوكي ملحوظ في مريض واحد مع أعراض معتدلة من عائلة أمريكية مرتبطة كروموسوم 8Q. ، تم العثور على انخفاض في مساحة المقطع العرضي لل50٪ على مستوى T9، مقارنة مع العمر والجنس الضوابط الملائمة. 113
لم يتم العثور على دليل على ضعف الميتوكوندريا كآلية من مرض في هذا الموضع على تحليل النسيجية أو البيوكيميائية خزعة العضلات مأخوذة من أحد أفراد المتضررين. 113
كروموسوم 10Q LOCUS SPG9

وقد تم ربط واحد نسب الإيطالي كبير إلى مكان SPG9 على الصبغي 10q23.3-24.2 في منطقة تمتد 12 سم. 64 متوسط ​​العمر عند ظهور الأعراض تختلف من الأول إلى العقد الثالث من العمر ويقترح المؤلفان الدليل على الترقب على مدى ثلاثة أجيال. النمط الظاهري السريرية هي واحدة من التعقيد HSP مع خزل سفلي تشنجي ارتباطهم إعتام عدسة العين الثنائية، الجزر المعدي المريئي مع القيء المستمر، وضمور عضلي القاصي الثانوية ما يبدو انه محور عصبي اعتلال الأعصاب الحركية. ونسب مع النمط الظاهري معقدة مماثلة من إعتام عدسة العين الخلقية وخزل سفلي تشنجي قد سبق وصفها والتي قد يثبت أيضا أن يكون راجعا إلى نفس الجين في موضع SPG9. 114
كروموسوم 12Q LOCUS SPG10

أحدث موضع ADHSP من يكتشفها هو SPG10 على الصبغي 12q13 تمتد منطقة سم 9.2 في عائلة بريطانية. 100 وكان متوسط ​​العمر عند ظهور الأعراض في أفراد الأسرة المتضررين الذين تقل أعمارهم عن تلك التي شوهدت في الأنساب SPG4، في 10.8 (SD 9.6) سنوات . كان النمط الظاهري واحد من الذهب الخالص HSP مع مجموعة واسعة من شدة المرض مع بعض المرضى الذين يحتاجون إلى كرسي متحرك في حين بقي آخرون عديمة الأعراض في سن 40 عاما.
ريد وآخرون وصفت نسب مزيد من الذي الربط لجميع الخمسة المعروفة مواضع ADHSP استبعدت، مما يشير إلى وجود واحد على الأقل أكثر لم تكتشف حتى الآن ADHSP مكان. 100

مقهورة HSP (ARHSP)

المرض المتنحي هو أقل شيوعا بكثير من الشكل السائد. كل من ينظر إلى الظواهر نقية ومعقدة. هناك عائلات الأقارب مرتبطة ثلاثة مواضع، SPG5 على الصبغي 8P، 115 SPG7 على الصبغي 16q 116، ومكان اكتشافها مؤخرا على الصبغي 15q، 117 والتي ليس لديها تعيين قاعدة بيانات الجينوم البشري الرسمي في الوقت الحاضر.
كروموسوم 8P LOCUS SPG5

موضع SPG5 على الكروموسوم 8p12-Q13 وأنه يمتد فاصل من 32CM. العائلات التونسية الأربعة مرتبطة SPG5 هي من النمط الظاهري النقي مع متوسط ​​العمر عند بداية تتراوح 1-20 سنة. لا يبدو أن هناك فرقا بين المظاهر السريرية لADHSP نقية وARHSP نقية. 115
كروموسوم 16Q LOCUS SPG7

موضع SPG7 على الكروموسوم 16q24.3 وفي الوقت الحاضر ثلاث عائلات وقد تم ربط هذا الموضع. النمط الظاهري هو غير متجانس مع العائلات على حد سواء نقية والمعقدة التي وجدت. وقد وصفت العائلة الأولية مرتبطة SPG7 كما نقية بالرغم من وجود ميزات إضافية، لا ينظر عادة في الخالص HSP، موجودة في هذه العائلة، التي أبلغ عنها DeMichele وآخرون، والتي شملت التلفظ. 116
وقد أعطيت البروتين المشفرة بواسطة SPG7 اسم paraplegin. في الآونة الأخيرة وقد وصفت لمتماثل الحذف 9.5 كيلو بايت في الإكسونات الخمسة الأخيرة من الجينات على الكروموسوم paraplegin 16q في هذا SPG7 الأسرة الأصلية المرتبطة. عندما تم عرض المزيد من المرضى لا علاقة لها مع HSP باستخدام واحد الذين تقطعت بهم السبل تعدد الأشكال التأكيد (SSCP) التحليل، تم تحديد اثنين من طفرات انزياح الإطار إضافية في الجين paraplegin. حدث واحد في الأسرة ARHSP نقية من إيطاليا، تم العثور على أعضاء المتضررين مما يدل على الحذف 2 سنة مضت في اكسون 6. آخر في الأسرة ARHSP المعقدة التي ملامح سريرية إضافية شملت ضمور العصب البصري، مع ضمور المخيخ القشرية وينظر في التصوير. وتألفت هذه الطفرة من الإدراج في المنطقة ترميز اكسون الماضي. كل ثلاثة SPG7 طفرات تؤدي إلى تشوهات كبيرة من البروتين paraplegin. Paraplegin هو عضو في metalloproteases الميتوكوندريا، التي هي مجموعة فرعية من عائلة بروتين AAA. ومن بين الأعضاء الآخرين من هذه المجموعة الفرعية الخميرة بروتينات الميتوكوندريا Afg3p وRcalp، والتي تظهر على حد سواء بروتين وكوصي مثل النشاط وتوطين إلى الغشاء الداخلي الميتوكوندريا. وقد أثبتت الدراسات استهداف والتعريب أن البروتين paraplegin localises إلى مقصورة التحت خلوية الميتوكوندريا. بعد العثور على أدلة على ضعف الميتوكوندريا في خزعة الأنسجة العضلية من أعضاء المتضررين من هذه العائلات يدعم مشاركة الميتوكوندريا في عملية المرض. تشوهات العضلات تتكون من وجود ألياف السلبية للأوكسيديز السيتوكروم والألياف الحمراء الممزقة والتي أظهرت تلطيخ مكثفة لسكسينات نازعة، والتغيرات التي تشير إلى انخفاض OXPHOS الميتوكوندريا. 104 A خزعة العضلات من مريض مصاب ARHSP مرتبطة كروموسوم 8Q لم تظهر أي دليل على الميتوكوندريا اختلال وظيفي، مما يشير إلى وجود آلية بديلة للمرض في هذا النوع من HSP. 113
تم التعرف ضعف الميتوكوندريا في بعض الاضطرابات العصبية. في بعض الأمراض مثل مرض باركنسون يبدو أنه قد يكون هناك مشاركة مباشرة من المجمعات السلسلة التنفسية. في رنح فريدريك ومرض هنتنغتون العيوب في OXPHOS يبدو أن الثانوية إلى تغييرات في البروتينات الأخرى من سلسلة الأنزيمات في الجهاز التنفسي. 118
مؤخرا تم التعرف على paraplegin المتعلقة AFG3L2 الجينات على الكروموسوم 18p11. 119 منتج الجين تنبأ له التماثل مع paraplegin، وATPases الخميرة الميتوكوندريا، Afg3p وRcalp، وAFG3L1، جين ذات الصلة. 119 120 كما تم أظهرت AFG3L2 في توطين لل مقصورة التحت خلوية الميتوكوندريا. مطلوب مزيد من التحقيقات لتحديد كيفية paraplegin شيوعا العيوب هي في أشكال مختلفة من HSP وإقامة إذا كان الأمر ينطوي AFG3L1 أو AFG3L2 أيضا في التسبب HSP، وخاصة في الأسر التي لديها النمط الظاهري معقدة، حيث قد تكون إصابات أجهزة متعددة تذكرنا المظاهر السريرية وجدت في اضطرابات الميتوكوندريا أخرى.
هذا النوع من الجينات يمكن أن تشارك في أمراض عصبية أخرى، ومن المثير للاهتمام أن AFG3L2 تقع داخل المنطقة من كروموسوم 18P الذي ارتبط شكل من أشكال مجهول السبب التواء خلل التوتر. 121
كروموسوم 15Q

بعد اكتشاف SPG5 وSPG7 لا يزال هناك ظلت الأسر ARHSP غير المرتبطة بأي مواضع. Murrilo آخرون اكتشفوا مؤخرا ما في الوقت الحاضر يبدو أن الأكثر شيوعا مكان لARHSP على الصبغي 15q13-15. 117 فحصوا ثماني عائلات وجدت أدلة على الربط هذا موضع جديد في سبعة.
النمط الظاهري في هذه الأسر هو متغير مع كل من الأشكال النقية ومعقدة يجري وصف. في الأسر نقية كان العمر عند بداية في العقد الأول في واحدة ويبلغ من العمر 43 عاما في الآخر، والذي تأثر واحد فقط من أفراد الأسرة. كان هناك أيضا التباين المظهري بين الأسر معقدة، وإن كانت هناك بعض ميزات مشابهة موجودة في أكثر من عائلة واحدة. وكان الأكثر إثارة للاهتمام ضمور أو عدم تخلق من الجسم الثفني البرهنة على التصوير بالرنين المغناطيسي، وينظر في كل الأشقاء المتضررين من أسرة واحدة وأحد أفراد المتضررين من آخر. في هذا العضو الأخير، تم العثور أيضا حول البطينات الدماغية تغييرات المادة البيضاء. وكان كل من هذه العائلات الأعمار مماثلة في بداية اعراض المرض في عقدهم الثاني وكان التخلف العقلي لاحظت ميزة في عضو واحد من كل عائلة. وكانت جمعيات أخرى مع الشلل النصفي التشنجي في هذا الموضع المحرك المختلط والاعتلال العصبي الحسي في عائلة واحدة وخلل المخيخ معتدل في اثنين آخرين.
رابطة HSP مرتبطة كروموسوم 15q مع عدم تخلق من الجسم الثفني والتخلف العقلي هي مثيرة للاهتمام لأنه قد ثبت أن الجين لمتلازمة Andermann أو عدم تخلق من الجسم الثفني والاعتلال العصبي المحيطي (ACCPN) لدينا أيضا الربط كروموسوم 15q. 122 و قد يكون أن هذا الشكل من متلازمة HSP وAnderman هم اضطرابات أليلية مع طفرات مختلفة في نفس الجين مما أدى إلى الظواهر متفاوتة. 117 ويعتبر هذا في X-مرتبطة HSP حيث طفرات مختلفة في صعود العطاء حزب العمال التقدمي الجين إما إلى النمط الظاهري HSP أو بليزايوس-ميرتسباخر المرض.

HSP المرتبطة X

على الرغم من X-مرتبطة HSP أمر نادر الحدوث، ويفهم جيدا نسبيا أساسها الوراثي الجزيئي.
هناك نوعان من مواضع مختلفة تم تحديدها لالعاشر مرتبطة HSP، SPG1 وSPG2. 60 123 أسر مع معقد HSP وقد تم ربط كل من SPG1 وSPG2، في حين تم فقط ربط النمط الظاهري نقية لSPG2.
المرتبطة X SPG2 LOCUS

HSP معقدة مرتبطة SPG2 يتكون من النمط الظاهري الأساسية من خزل سفلي تشنجي، متلازمة المخيخ، والتخلف العقلي. ويعتبر الاختلاف Interfamilial مع الميزات الأساسية التي تحدث بدرجات مختلفة مع أو بدون ميزات إضافية مثل ضمور العصب البصري. وبالمثل، يحدث الاختلاف داخل الأسرة. 124 125 قد تم الإبلاغ عن هذا الوصف في وقت سابق من الأسر المرتبطة X. 126
الجين في موضع SPG2 هو البروتين شحم بروتيني (حزب العمال التقدمي) الجينات. ومن المعروف أن الطفرات، والأكثر شيوعا الازدواجية، في هذا الجين لتسبب المرض بليزايوس-ميرتسباخر (PMD). هذا هو مرض dysmyelinating التي تؤثر على الجهاز العصبي المركزي الذي يتكون من المخيخ والهرمية علامات الظهور في وقت مبكر، مع التقدم السريع يؤدي إلى الوفاة عادة في مرحلة الطفولة أو في مرحلة الطفولة. وقد ثبت الأنساب HSP معقدة مرتبطة بموضع SPG2 أن الطفرات في الجين حزب العمال التقدمي في الإكسونات 3B، 4، أو 6. 127 128 طفرات مختلفة لذلك في نفس الجين يمكن أن تنتج أي النمط الظاهري PMD أو HSP النمط الظاهري تعقيدا. حزب العمال التقدمي هو بروتين النخاعين الرئيسية المشاركة في كل من النضج المايلين والصيانة في الجهاز العصبي المركزي. هو النمط الظاهري أقل حدة والتنمية في وقت لاحق من علامات في SPG2 مقارنة مع PMD يرجع ذلك إلى حقيقة أن حزب العمال التقدمي لديه الإسوي أصغر، DM-20. في كل SPG2 وPMD، يتم تخفيض تركيزات حزب العمال التقدمي، في حين يتم تقليل تركيز DM-20 بشكل كبير إلا في PMD. ويعتقد أن ايزومرات لهما تأثيرات مختلفة قليلا على المايلين. يبدو أن الإسوي DM-20 أن تكون المشاركة بشكل أساسي في المايلين النضج في حين شكل الإسوي حزب العمال التقدمي، وهو ما يعبر عنه في مرحلة لاحقة من التطور، له دور في الضغط رقة المايلين والصيانة. وسيتم تجميع الأغماد المايلين في عداد المفقودين البروتين حزب العمال التقدمي وعلى الرغم من أنها يمكن أن تعمل هذه دوران في نهاية المطاف الخضوع متسارعة. 129 قد تفسر هذه الاختلافات التباين المظهري تميز بين SPG2 وPMD.
تم العثور على أسرة تعقيدا مع الربط إلى المنطقة التي تحتوي على مكان SPG2، مع عدم وجود طفرة في جين تم تحديدها حزب العمال التقدمي. يقترح المؤلفان أن هذا قد يمثل دليلا على وجود مكان ثالث قريب لالعاشر مرتبطة HSP. 130 ومع ذلك، في نسبة من المرضى الذين يعانون من PMD لم يتم تحديد أي طفرات. 131 132 وهذا يمكن أن يكون بسبب وجود الطفرات غير المعترف بها في غير الترميز مجالات الجين، أو بسبب وجود طفرة في جين المجاور تشارك في أي حزب العمال التقدمي تنظيم الجينات أو تشكيل المايلين.
النقي HSP المرتبطة X هي نادرة جدا، مع خمس عائلات فقط وصفت في الأدب حتى الآن. 123 133-136 اثنان من هذه العائلات تم ربطها موضع SPG2. 123 133 في واحد فقط من هذه الأسر تم العثور على استبدال قاعدة واحدة في اكسون 5 من الجين حزب العمال التقدمي، تظهر هذه النسب من الذهب الخالص HSP أن تكون أليلية إلى تعقيدا HSP (SPG2) وPMD.
المرتبطة X LOCUS SPG1

أسرة مع معقد HSP مرتبطة SPG1 اتسم الاختلافات المظهرية مقارنة مع النسب السابقة، والتي تضمنت عدم مشاركة المخيخ، والتخلف العقلي الشديد، والتشوهات العضلية الهيكلية الخلقية، وأبرزها غياب الباسطة الطويلة لإبهام القدم. 60 يعتبر هذا النمط الظاهري المقرر أن طفرة في اكسون 26 من L1 جزيء التصاق الخلية (L1CAM) الجينات. 61 L1CAM هو بروتين سكري transmembrame التي يعبر عنها بشكل رئيسي من قبل الخلايا العصبية وخلايا شوان. أنها تلعب دورا أساسيا في تطوير الجهاز العصبي، وتورطهم في نمو محور عصبي والاستطلاعية. طفرات مختلفة في هذا الجين تؤدي إلى متلازمات من MASA (التخلف العقلي، وفقدان القدرة على الكلام، خلط مشية، واعترض المقرب)، استسقاء الرأس X-مرتبط، وعدم التخلق X-ربط من الجسم الثفني. هناك الكثير interfamilial والتباين داخل الأسرة في الأسر التي لديها طفرات في الجين L1CAM. فمن الممكن أن يكون أعضاء مع مختلف الظواهر ضمن عائلة واحدة. ويشار إلى أن الأمراض الآن لأنها جزء من CRASH السريرية متلازمة (الجسم الثفني تنسج، والتخلف، اعترض المقرب، الشلل النصفي التشنجي، واستسقاء الرأس). 137

استنتاج

فإنه ليس من المستغرب أن هناك صعوبات مبكرة في محاولة لتصنيف HSP، التي تمثل مجموعة غير متجانسة من الأمراض التي قد تشارك في أفضل مسار مشترك النهائي في عملية التنكسية العصبية. التصنيف الوراثي الجزيئي بدأت الآن لتحديد حدود الشروط والارتباط الوراثي / ملامحهم.
في الوقت الحاضر، والطفرات في الجينات الأربعة. وقد تم تحديد L1CAM، حزب العمال التقدمي، paraplegin، وspastin كما لعب دورا في تطور النمط الظاهري HSP، مع هوية الجينات في سبعة مواضع أخرى لا تزال مجهولة. الاكتشاف الأخير من spastin وparaplegin الجينات يفتح حقبة جديدة من الفرص المثيرة التي يمكننا أن نبدأ في التحقيق في علم وظائف الأعضاء من الجهاز الحركي وعملية التنكسية التي تتعرض لها، ونأمل توفير فرص لتلقي العلاج. يمكن أن يتوقع في المستقبل القريب والتي سوف تعزيز فهمنا لهذه الأمراض اكتشاف الجينات المتبقية ومنتجاتها.
وجود هذا التباين الوراثي الكامنة HSP يذهب بعض طريقة لشرح التباين المظهري ملحوظ ينظر بين العائلات. ومع ذلك، فإن النتيجة المتمثلة في التباين داخل الأسرة مماثل لا يمكن تفسيرها إلا من خلال وجود عوامل التعديل وراثية أو تفاعل غير معروف مع البيئة. ماير وآخرون أظهرت طفرات في نقل الغلوتامات EAAT2 الجينات، في اثنين من أصل سبعة أفراد الأسرة المصابين مع خالص HSP. أنها تفترض أن التفاعل مع البديل أليلية من EAAT2 والخلل الجيني الأساسي غير معروف قد تكون مسؤولة عن التباين المظهري ينظر داخل أسرهم. 138
على الرغم من التقدم في علم الوراثة من HSP، وحتى الآن لم يكن هناك القليل نسبيا من أهمية التشخيص. هذا قد يتغير الآن مع اكتشاف الجين spastin، والطفرات التي قد تكون مسؤولة عن ما يصل الى 50٪ من ADHSP. عند رؤية المريض مع الممكن HSP، تبقى الخطوة الأولى لاستبعاد الحالات المرضية الأخرى. والتحليل الجيني توفر إمكانية التشخيص الدقيق في الحالات التي يتم فيها تحديد الطفرات. هذا وسوف توفر في نهاية المطاف إمكانية تشخيص سابق للأعراض أو حتى قبل الولادة في الأسر الذين يرغبون في الخضوع لهذا الاختبار. ومع ذلك، حتى يتم فهم مجموعة تغيري الكامل لهذه الجينات، والجدوى التقنية لإقامة مثل هذه التحليلات لا يزال غير واضح. هذه هي الجينات multiexon مع مختلف التحولات، وبالتالي فإن تحديد طفرة قد لا تكون واضحة بشكل خاص. إمكانية التشخيص الدقيق بالرغم من ذلك تبشر مجالا جديدا للإدارة في HSP. في السنوات المقبلة يمكن أن يتوقع المزيد من التقدم السريع، سواء في تحديد جينات جديدة HSP ذات الصلة وفي بيولوجيا الخلايا الكامنة وراء انحطاط نظام المحرك.

رافت ابراهيم 11-22-2015 08:02 PM

الطيف من الطفرات spg4 في راثي الشلل النصفي التشنجي المهيمن
 
http://hmg.oxfordjournals.org/content/9/4/637.full


وراثي جسمي الشلل النصفي التشنجي وراثي (AD-HSP) هو مجموعة من الاضطرابات العصبية غير المتجانسة وراثيا تتميز التشنج التقدمي المؤيد في الأطراف السفلية. تم تعيين خمسة مواضع AD-HSP إلى الكروموسومات 14Q، 2P، 15q، 8Q و12q. وقد تبين موضع SPG4 في 2p21-P22 لحساب ~40٪ من جميع الأسر AD-HSP. spastin ترميز SPG4، وهو بروتين AAA النووي المزعوم، وقد تم مؤخرا تحديد. هنا، وقد أدى تحليل تسلسل 17 الإكسونات من SPG4 في 87 لا علاقة لها المرضى AD-HSP في الكشف عن 34 طفرات جديدة. وتنتشر هذه الطفرات SPG4 على طول المنطقة ترميز الجين وتشمل جميع أنواع التعديل DNA بما في ذلك مغلطة (28٪)، هراء (15٪) ونقطة لصق موقع (26.5٪) الطفرات وكذلك الحذف (23٪) والإدراج (7.5٪). وكشف التحليل السريري للشركات طفرة 238 نسبة عالية من كلا الناقلين أعراض (14/238) والمرضى غير مدركين للأعراض (45/238)، ويسمح لإعادة تعريف هذا النموذج المتكرر للAD-HSP.
القسم السابق القسم التالي
تلقى 16 نوفمبر 1999؛ المنقحة ومقبول 5 يناير 2000.

مقدمة

الشلل النصفي التشنجي وراثي (HSP) هو مجموعة من الاضطرابات العصبية سريريا وغير متجانسة وراثيا تتميز بشكل رئيسي من قبل التشنج التدريجي والثنائي في الأطراف السفلية. الميزات المرضية الرئيسية للHSP هي انحطاط مساحات هرمي عبرت والتخفيف من الأعمدة الظهرية (1). تم تصنيف HSP وفقا لطريقة الميراث وجود أو عدم وجود أعراض إضافية. وقد تم تقسيمها إلى شكلين (2) اعتمادا على ما إذا التشنج يحدث في عزلة (HSP النقي) أو ما يرتبط بها مع مجموعة واسعة من الميزات سريرية إضافية (معقدة HSP). على الرغم من كل أشكال يمكن أن تكون موروثة في جسمية مهيمنة (AD-HSP)، وراثي متنحي (AR-HSP) أو (X-HSP) بطريقة ترتبط X كروموسوم، الشلل النصفي التشنجي النقي هو الشكل الأكثر شيوعا من AD-HSP . وقد ميز مجموعتين فرعيتين من AD-HSP وفقا لعمر في بداية (3، 4)، واحدة مع بداية <35 عاما (النوع الأول) والآخر مع بداية> 35 عاما (النوع الثاني). واقترح في وقت لاحق (5) بأن بزوغ فجر في 20 سنة من العمر قد تكون النقطة الفاصلة أكثر تمييزا لتجنب التداخل بين النوع الأول والنوع الثاني. ومع ذلك، فإن الاختلاف الملحوظ في سن بداية صفها على حد سواء بين وداخل الأسر وأشار إلى أن هذا المعيار تصنيف الأمراض غير مناسب التصنيف الفرعي لHSP (6).
وقد تبين النقي AD-HSP أن يكون مغاير وراثيا متجانس (7)، وقد تم تحديد خمسة مواضع حتى الآن على الكروموسومات 14Q (SPG3) (7)، 2P (SPG4) (8، 9)، 15q (SPG6) (10 )، 8Q (SPG8) (11) و12q (SPG10) (12). ما يقرب من 40٪ من الأنساب AD-HSP تظهر الربط كروموسوم 2P، مما يدل على ارتفاع معدل انتشار موضع SPG4 في هذا الشكل من المرض (13 - 15). بعد استبعاد إمكانية تكرار التوسع CAG في SPG4 AD-HSP (16)، ولقد عزل مؤخرا الجينات الكامنة وراء هذا النوع من AD-HSP باستخدام استراتيجية استنساخ الموضعية على أساس التسلسل الفاصل SPG4 بأكمله، وحددنا خمس طفرات مختلفة في سبع عائلات (17).
SPG4 (المعروف أيضا باسم SPAST؛ بنك الجينات انضمام أي AJ246003) يمتد على مسافة المادية لل~90 كيلوبايت، يتكون من 17 الإكسونات ويشفر عضوا النووي المزعوم من AAA [A TPases على ssociated مع الخلوية متنوع الأنشطة المحددة (18، 19 )] عائلة بروتين، يدعى spastin (بنك الجينات انضمام رقم AJ246001) (17). وقد اقترح تعديلات DNA خمسة (هراء واحد، لصق موقع واحد وثلاثة الطفرات مغلطة) الكشف حتى الآن في سبع عائلات AD-HSP بشكل غير متوقع أن هذه النتائج المهيمنة مرض التنكسية من فقدان وظيفة (17). في محاولة لإنشاء الارتباطات-النمط الظاهري النمط الجيني وتقييم وتيرة الطفرات SPG4 في AD-HSP، قمنا بترتيب SPG4 للطفرات في 17 SPG4 -linked قبائل AD-HSP إضافية وكذلك في 70 AD-HSP أسر مع الربط غير معروف .

النتائج

الطفرات SPG4 في الأسر AD-HSP

كما تم عرض عضوين المتضررين والسيطرة موضوع واحد من كل من 17 SPG4 الأسر -linked واحد الفرد المصاب من كل من 70 قبيلة مع الربط غير معروف للطفرات في SPG4 باستخدام PCR التضخيم وتحليل تسلسل بكل exons 17. ما مجموعه 39 طفرات مختلفة، بما في ذلك التعديلات DNA الخمس المذكورة سابقا (17)، تم الكشف في 44 الأسر AD-HSP (الجدول 1) تنشأ من مختلف الخلفيات الجغرافية (25 من فرنسا، و 5 من البرتغال، 3 من كل من سويسرا وإيطاليا وأيرلندا، و 1 في كل من المملكة المتحدة وألمانيا وإسبانيا وبولندا وتاهيتي). الطفرات في SPG4 المشارك تفصل مع المرض في 22 من 24 SPG4 -linked الأسر AD-HSP وفي 22 من 70 AD-HSP القبائل مع الربط غير معروف. النظر في جميع الأسر AD-HSP أن درسنا إما عن طريق تحليل الربط أو عن طريق فحص الطفرة، وتشير نتائجنا أن SPG4 HSP تمثل 37٪ على الأقل من AD-HSP.

الجدول 1.
الطفرات SPG4 في المرضى الذين يعانون من AD-HSP

وأكد اثنين من السمات البارزة في هذه الدراسة. (ط) وقد ثبت أن جميع أنواع التعديل DNA بما في ذلك 9 الحذف، 3 غرز و 27 استبدال قاعدة (11 مغلطة، 6 هراء و10 الطفرات موقع لصق) أن تؤثر SPG4 تقريبا في كل اكسون أو مواقع لصق المجاورة (الشكل 1). (ب) فيما عدا ثلاث طفرات (1416C → T، 1340del5 و1813-2a ز →) التي تم الكشف عنها في أكثر من قبيلة، وهي مختلفة طفرة المشارك يعزل مع المرض في كل عائلة. ومن بين هذه التعديلات تسلسل 39، 11 الطفرات (28٪) تؤدي إلى استبدال الحمض الأميني في تسلسل spastin في حين لا يقل عن 19 الطفرات (50٪) يؤدي إلى بروتين اقتطاع (الجدول 1). وقد تم تحديد أحد عشر الطفرات لصق موقع بما في ذلك حذف واحد وعشرة بدائل لدينا قاعدة في عينة الأسرة، وهو ما يمثل ~28٪ من الطفرات SPG4 الكشف حتى الآن.
http://hmg.oxfordjournals.org/conten...7/F1.small.gif
الشكل 1. تمثيل تخطيطي من الجين SPG4 بما في ذلك توطين 39 الطفرات الكشف حتى الآن. يتم رسمها 17 الإكسونات من SPG4 تقريبا الحجم. يشار إلى تسلسل النووية ترميز spastin الحفاظ المجالات التي ألوان مختلفة: المفترضة إشارة توطين النووية (وظائف الأحماض الأمينية 11/07) في البرتقال، وهما الزخارف يسين سستة (وظائف الأحماض الأمينية 50-78 و508-529) باللون الأزرق، وكر زخارف A، موقع ATP ملزم، وB (وظائف الأحماض الأمينية 382-389 و437-442، على التوالي) باللون الأخضر، والحد الأدنى من التوافق AAA (وظائف الأحماض الأمينية 480-498) باللون الأصفر والحلزون حلقة حلزون تم تأطير مجال dimerization (بين المواقف الأحماض الأمينية 478-486) ​​من خلال شرطات في اكسون 12. الساحات، والطفرات مغلطة. الدوائر، والطفرات هراء. مثلثات، microdeletions. مثلثات مقلوبة، الإدراج؛ مقص، والطفرات موقع لصق.

الطفرات مغلطة والمجالات الوظيفية spastin

على الرغم من أن وجدت هذه الطفرات 39 المنتشرة على طول SPG4، باستثناء الإكسونات 1 و 4 و 6 و 17، يتم ترجمة كل 11 الطفرات مغلطة بين الإكسونات 7 و 16 (الشكل 1). وقد أظهرت هذه المنطقة من SPG4 لتتوافق مع مجال أتباز الحفظ جدا (17)، وتسمى أيضا الكاسيت AAA، الذي يتوقع أن تؤوي النشاط أتباز في أفراد الأسرة AAA (20). من 11 الطفرات مغلطة، ثمانية تؤدي إلى جذرية التغييرات الأحماض الأمينية بينهم أربعة بدائل تنطوي cysteines، في حين أن الثلاثة المتبقية، 1288A → G (K388R)، 1401C → G (L426V) و1792C → T (A556V)، يؤدي إلى الأحماض الأمينية المحافظ التغييرات (الجدول 1). هذه التعديلات تسلسل ثلاثة تقع في الإكسونات 8 و 10 و 15 على التوالي، لم تكتشف في 96-124 الكروموسومات السيطرة، مشيرا إلى حالة تحور بهم. وجود المحافظة تغييرات الأحماض الأمينية قد تكشف عن أهمية وظيفية من هذه المخلفات المتضررة. هنا، واثنين من الطفرات مغلطة، 1283T → G (N386K) و1288A → G (K388R) وقد أظهرت، أن تؤثر على spastin وكر الحافز والذي يتوافق مع المجال ATP ملزم لجميع ATPases (21). ومن المثير للاهتمام، ونتائج الطفرة 1283T → G في غير المحافظ تغيير الأحماض الأمينية (N386K) في موقف غير المحفوظة 5 من وكر أدنى فكرة الإجماع A، GPPG X GKT (تحور الحمض الأميني بالخط العريض)، في حين أن الطفرة 1288A → G يولد تغيير المحافظ (K388R) في موقف غاية الحفاظ جيدا 7 من وكر عزر A. وتشير هذه البيانات مجتمعة أن Lys388 تشارك مباشرة في ملزمة ATP، وبالتالي يبدو أن تكون حاسمة من أجل وظيفة spastin.

الأشكال

وأجري تحليل تسلسل بكل exons SPG4 والحدود اكسون-إنترون خارجا على 142 فردا (واحد لم يتأثر وعضوين المتضررين من 24 SPG4 الأسر -linked ومريض واحد من كل من 70 قبيلة غير المرتبطة). على الرغم من أن هذا التحليل يكشف وجود intronic الأشكال واحدة النوكليوتيدات (النيوكلوتايد)، فإنه فشل في الكشف عن أي تعدد الأشكال في الإكسونات الترميز، بما في ذلك التغيرات كودون مرادف أو المحافظة على الكروموسومات غير الحاملة والمناطق غير تحور من الكروموسومات الحاملة.

التحليل السريري للمرضى SPG4

وقد تم تحديد ما مجموعه 238 ناقلة تحور بما في ذلك 179 مريضا على بينة من أعراض في 44 SPG4 الأسر. كان النمط الظاهري الشلل النصفي التشنجي النقي في 41 من هذه الأسر ولوحظ شكل معقد من AD-HSP المرتبطة مع وجود علامات المعرفية في ثلاث قبائل. وتظهر الخصائص السريرية الرئيسية لأفراد الأسرة المتضررين في الجدول 2. وكان ما مجموعه 45 مريضا (~20٪) غير مدركين للأعراض في الامتحان رغم أن 10 منهم تأثرت بالتأكيد، 30 ربما تأثرت و5 كان احتمال الشلل النصفي التشنجي. بالإضافة إلى ذلك، 14 ناقلة أعراض (متوسط ​​العمر عند فحص 36 ± 18 عاما، ومجموعة 19-73 سنة) تم الكشف عنها بواسطة هذا الفحص الطفرة. متوسط ​​العمر عند بداية كان 29 ± 17 عاما، ومجموعة 0-74 سنوات، وهو ما يتسق مع بداية الكبار تحديدها ل61 مريضا من 12 SPG4 -linked قبائل AD-HSP (29 ± 15 عاما) (13). ومع ذلك، فإن التوزيع من العمر في بداية لأعضاء المتضررين من 44 SPG4 الأسر (الشكل 2) أظهرت أن 40٪ من المرضى قد بدء قبل 30 عاما.
http://hmg.oxfordjournals.org/conten...7/F2.small.gif
الشكل 2. توزيع العمر عند بداية في 172 SPG4 المرضى.


الجدول 2.
الخصائص السريرية للمرضى SPG4

كان العرض الأولي لظهور غدرا من تصلب في الساقين عن 86٪ من المرضى (130/151). تسعة عشر في المائة من أفراد الأسرة المتضررين (28/151) اشتكى من عدم الثبات بالمشي أو السقوط، و 5٪ (8/151) عانت من ألم في الأطراف السفلية. علامات الهرمية كانت مرتبطة بنسب مختلفة مع العديد من المظاهر السريرية التي كثيرا ما لوحظ في الشلل النصفي التشنجي النقي، مثل انخفاض الشعور اهتزاز في الأطراف السفلية (58٪)، والإلحاح البولي (38٪)، قدم جوفاء (21٪)، والجنف (5٪ ). أيا كان المخيخ مشية ترنح ولكن تم تشخيص متلازمة المخيخ خفيفة في الأطراف العلوية في أربعة مرضى. ولم يكن لدى أي علامات باركنسوني، خلل التوتر أو نقصان في حدة البصر. وقد لوحظت ردود الفعل السريع في الأطراف العلوية في 27٪ من المرضى.
وكانت شدة المرض متغير بدرجة كبيرة بين المرضى (الجدول 3). قارنا تردد من العلامات السريرية بين أربع مجموعات من المرضى تظهر زيادة مدة المرض (الشكل 3). بحضور مختلف الأعراض تختلف مع مدة المرض: الداني ضعف الطرف السفلي (P <0.001)، القريبة والهزال البعيدة (P <0.001)، وانخفضت شعور الاهتزاز في الأطراف السفلية (P <0.001)، التشنج في بقية (P < كانت 0.05) والبولي الاستعجال أو سلس البول (P <0.01) بشكل ملحوظ أكثر تواترا مع زيادة مدة المرض (الشكل 3). على النحو الذي اقترحه هاردينغ (3)، والنمط الظاهري من المرضى الذين يعانون من الاصابة المبكرة (≤35 عاما) يختلف عن الأفراد المتضررين مع بداية الراحل (> 35 سنة). على الرغم من أن وتيرة علامات سريرية مماثل بين المجموعتين من المرضى، وكان تطور المرض يحددها مؤشر شدة أسرع بشكل ملحوظ في المجموعة متأخرة بداية (P <0.001) (الشكل 4)، وهو ما يؤكد البيانات هاردينغ (3).
http://hmg.oxfordjournals.org/conten...7/F3.small.gif
الشكل 3. تطور العلامات السريرية بوصفها وظيفة من مدة المرض. المرضى الذين يجهلون أعراض = 45)، والأفراد المتضررين مع مدة المرض بين 0 و 14 سنة = 64)، ما بين 15 و 29 سنة = 72) و> 30 عاما = 36). LL، الأطراف السفلية، UL، الأطراف العلوية. قيم P تمثل فروق ذات دلالة إحصائية في كل علامات سريرية بين أربع مجموعات مختلفة من المرضى الذين يعانون من زيادة مدة المرض: * P <0.05، ** P <0.001.

http://hmg.oxfordjournals.org/conten...7/F4.small.gif
الرقم 4. مرض تقدم بوصفها وظيفة من مدة المرض لكل مرحلة العجز في المرضى الذين يعانون من بداية قبل أو بعد 35 سنوات.


الجدول 3.
متوسط ​​مدة المرض وفقا لمراحل الإعاقة

كان انتفاذ سن المعالين وغير مكتملة حتى في ناقلات طفرة القديمة. وكان المريض البالغ من العمر 73 عاما (من 1611 عائلة) مع طفرة موقع لصق بدون أعراض تماما في الامتحان، في حين أقدم يتأثر الفرد يجهل الأعراض ولكن سريريا المتضررين والذين تتراوح أعمارهم بين 62. انتفاذ، وهذا هو الذي يعرف بأنه نسبة حاملات التحور أعراض ، وزيادة مع عمر في الامتحان، من 60٪ في مجموعة من المرضى الأصغر سنا (10-19 سنة) إلى 76٪ في 20- للمرضى البالغ من العمر 40 عاما و 85٪ بعد 40 سنوات.

راثى-النمط الظاهري علاقة

مقارنة بين الظواهر لاحظت في المرضى الذين يحملون طفرة مغلطة = 36) مقابل المرضى الذين يعانون من spastin اقتطاع = 103) فشلت في الكشف عن أي اختلاف في وتيرة علامات سريرية وشدة المرض الذي قدر قبل مدة المرض يعني في كل مرحلة العجز. وعلاوة على ذلك، ونحن لم نلاحظ أي اختلاف كبير في السن عند بداية بين المرضى الذين يعانون من طفرة مغلطة والمرضى الذين يعانون من البروتين اقتطاع (24 ± 18 مقابل 31 ± 17، P = 0.08). الظواهر من المرضى يحملون طفرة مغلطة المحافظة (أسر 019، 027 و 627) مماثلة لتلك التي لوحظت في المرضى الذين يعانون من طفرة مغلطة غير متحفظة أو بروتين اقتطاع: كانت المظاهر السريرية لا أقل تواترا أو أقل حدة في المرضى الذين يعانون من مغلطة المحافظة الطفرات، والتي تميل إلى تأكيد أهمية البقايا تتأثر هذه التغييرات في وظيفة spastin.

نقاش

SPG4، ترميز عضوا جديدا في أسرة البروتين AAA، ومؤخرا تم تحديدها على أنها المسؤولة عن الشكل الأكثر شيوعا للAD-HSP (17). تم العثور على خمس طفرات متخالف مختلفة تقع في المنطقة الترميز لهذا الجين في سبع عائلات AD-HSP. في هذه الدراسة، وقد أدى تحليل تسلسل 17 الإكسونات من SPG4 في 87 مريضا لا علاقة لها المتضررة مع AD-HSP في الكشف عن 34 طفرات جديدة. النظر في جميع الأسر AD-HSP التي تم التحقيق فيها إما عن طريق تحليل الربط أو عن طريق فحص الطفرة، ونحن قد تأكد من SPG4 حسابات AD-HSP عن 37٪ من جميع AD-HSP. وتتناثر 39 SPG4 الطفرات الإبلاغ عنها حتى الآن على طول المنطقة ترميز الجين وتشمل مغلطة (28٪) وهراء (15٪) الطفرات والحذف (23٪)، المدرجة (7.5٪) والطفرات نقطة لصق موقع (26.5٪ ). كما اقترح سابقا (17)، وجميع هذه الأنواع من تغيير الحمض النووي تشير إلى أن هذا النوع من AD-HSP النتائج من فقدان وظيفة spastin (22).
الطفرات موقع لصق، والحذف أو الإدراج توليد البروتين اقتطاع كلها ضارة لأنها يبدو أن يؤدي إلى النصوص الشاذة غير مستقرة، وبالتالي قد يؤدي إلى انخفاض في spastin. Haploinsufficiency، على الرغم من غير متوقعة للجسمية مهيمنة اضطراب الاعصاب، وقد لوحظ في 50٪ على الأقل من SPG4 الأسر AD-HSP تحليلها حتى الآن. من ناحية أخرى، يتم ترجمة كل الطفرات مغلطة ضمن المجال الوظيفي spastin، وAAA كاسيت المذكور، وبالتالي قد يتسبب في فقدان نشاطها. منذ spastin ينتمي إلى عائلة البروتين AAA، فإنه يمكن أن تشارك في الجمعية، وظيفة أو التفكيك المجمعات البروتين وبالتالي يكون بمثابة جزيء كوصي (23). طفرات ينتج فقدان وظيفة إما عن طريق تثبيط المجال الوظيفي أو انخفاض في كمية spastin قد تسبب بالتالي انخفاضا في عدد من المجمعات البروتين الوظيفية التي تعتبر حاسمة للحفاظ محور عصبي في مجموعة فرعية من الخلايا العصبية. في هذه الحالة، يمكن أن يعزى إلى الناتج الخلل مع البروتينات يقابل تشكيل هذه المجمعات النمط الظاهري غير طبيعي. ومع ذلك، فإن احتمال أن spastin عادة تعمل على مقربة من مستوى عتبة لا يمكن استبعاده. كل من فرضيات يمكن حساب التغير المهم في شدتها والعمر في البداية، وانتفاذ غير مكتملة من SPG4 AD-HSP.
كما لوحظ في غيرها من الصفات السائدة والمتنحية وراثي جسمي المسببة للأمراض، مثل PAX6 مسؤولة عن انعدام القزحية (24) وأجهزة الصراف الآلي وراء ترنح توسع الشعيرات (25)، أكثر من 39 SPG4 الطفرات الكشف بحيث يؤدي بكثير من البروتين اقتطاع بينما 28٪ فقط هي الطفرات مغلطة. وعلاوة على ذلك، وتواتر SPG4 لصق الطفرات الموقع (28٪) هو أعلى بكثير من تلك التي ذكرت في الاستطلاعات من الاضطرابات الجينية البشرية الأخرى، التي وجدت 15٪ من الطفرات تؤثر مرنا الربط (26، 27). ومن المثير للاهتمام، يمكن تحديد أي تعدد الأشكال الترميز (cSNPs)، بما في ذلك الأشكال مرادفة، في الإكسونات SPG4 كما وصفها كارجيل وآخرون. (28) ل13 من 106 الجينات التي تم تحليلها في مسح منهجي لcSNPs. غياب cSNPs على الكروموسومات غير الحاملة وجود الطفرات مغلطة المحافظة قد توحي بأن أي استبدال قاعدة التي تؤثر على تسلسل SPG4 الترميز هو ضار. ومع ذلك، فإن توطين الطفرات مغلطة المحافظة الثلاثة داخل الكاسيت AAA يميل إلى تسليط الضوء على أهمية وظيفية من بعض المخلفات مقارنة مع الآخرين.
قادنا التحليل السريري من 224 مريضا يحملون طفرة في SPG4 لإعادة تعريف هذا النموذج المتكرر للAD-HSP. SPG4 AD-HSP لا ينبغي النظر فيه إلا بوصفه النموذج الذي يصيب البالغين من HSP، على عكس ما كان في السابق اقترح (8، 13)، حيث أن 40٪ من المرضى البدء بها قبل 30 عاما. ومع ذلك، فإن متوسط ​​العمر عند بداية هو في وقت لاحق، ومجموعة من الأعمار في بداية أكبر في SPG4 AD-HSP مما كانت عليه في غيرها من أشكال HSP مثل SPG3، SPG5 أو SPG7. معظم المرضى الذين عرض علامات الهرمية (أي زيادة ردود الفعل في الأطراف السفلية، وردود الفعل الباسطة أخمصي، رمع الكاحل وضعف العضلات في الأطراف السفلية) وانخفض شعور الاهتزاز في الكاحلين. كانت علامات الكلاسيكية الأخرى من الذهب الخالص HSP مثل اضطرابات العضلة العاصرة والعضلات البعيدة الهزال في الأطراف السفلية، قدم جوفاء، الجنف أو متلازمة المخيخ خفيفة في الأطراف العلوية أقل تواترا. كما تم العثور على هذه العلامات بنسب مختلفة في أشكال أخرى من AD-HSP. وكان ضعف الادراك أعراض غير نمطية الوحيد لوحظ في 9 من 19 فردا المتضررين من ثلاث قبائل. وكانت شدة المرض اختلافا كبيرا داخل وبين العائلات على حد سواء: لاحظنا حاملات التحور أعراض> 70 عاما وكذلك المرضى المصابين بشدة الذين كانوا على كرسي متحرك محددة في العقد الثالث.
لقد أكد أن تطور المرض في المرضى الذين يعانون من تأخر ظهور SPG4 AD-HSP هو أسرع بكثير مما كان عليه في المرضى الذين يعانون من الاصابة المبكرة، وهو ما يتسق مع استنتاج هاردينغ على العام AD-HSP (3). وقد أنشأت نتائجنا أيضا أن تقلب النمط الظاهري يعتمد بشكل واضح على مدة المرض في SPG4 AD-HSP. كل من اضطراب وظيفي يقاس على نطاق والعجز خمس نقاط وتردد بعض العلامات السريرية مثل الضعف والهزال ونقص الشعور اهتزاز في الأطراف السفلية، واضطرابات العضلة العاصرة والتشنج في زيادة الراحة مع مدة المرض. لم مقارنة بين الظواهر بين الناقلين طفرة مغلطة والمرضى الذين يعانون من spastin اقتطاع لم تكشف عن أي اختلاف كبير في تطور المرض، شدة الأعراض أو العمر عند بداية. على الرغم من أن هذه النتائج تحتاج إلى تأكيد لعينات المرضى أخرى، فإنها تشير إلى أن الطفرات مغلطة من غير المرجح أن تمارس التأثير المهيمن سلبية على النشاط spastin الذي ينبغي أن يؤدي إلى النمط الظاهري أشد من اقتطاع الطفرات المنتجة haploinsufficiency. وينبغي توفير مزيد من التوضيح للآلية الجزيئية الكامنة وراء هذا اضطراب الاعصاب من خلال إنشاء نماذج الماوس لSPG4 AD-HSP إما مع طفرة مغلطة أو بروتين اقتطاع.
كما تبين للSPG7 الطفرات (29)، وكلاهما أشكال نقية ومعقدة من AD-HSP تسببها طفرات SPG4 منذ عقدين من هراء ومغلطة واحد الطفرات شارك تفصل مع المرض في العائلات 2971، 1010 و 1002، والتي تعرض لشلل سفلي تشنجي المرتبطة مع وجود علامات المعرفية. وتشير هذه النتائج إلى أن التمييز بين نقية وتعقيدا لا تزال غامضة. ومع ذلك، كان الخرف غير موجودة في جميع الأفراد المتضررين (19/9) من هذه العائلات الثلاث وليس الطفرات SPG4 تم الكشف في أسر أخرى مع معقد AD-HSP. لذلك، نقية AD-HSP لا تزال حتى الآن العرض الأكثر شيوعا من العيوب spastin. النظر في تمديد الجيني geneity heterog من AD-HSP، ينبغي أن تستند إلى معيار تصنيف الأمراض أكثر دقة في مواضع مختلفة مسؤولة عن HSP.
أول تطبيق لتحديد الجينات المسببة للمرض هو وضع التشخيص الجزيئي قبل وبعد الولادة من الفوضى. يبدو واضحا الآن أن التشخيص الدقيق للSPG4 AD-HSP لا يمكن الحصول عليها عن طريق تحليل طفرة بسبب النسبة العالية من كلا الناقلين طفرة أعراض والمرضى يجهلون الأعراض. إذا يمكن الكشف عن المرضى الأخير قبل الفحص السريري التفصيلي، لا يمكن تحديدها ناقلات أعراض التي كتبها التحليلات الجزيئية. هذه الملاحظة وتباين داخل الأسرة ملحوظ في شدة تجعل الاستشارة الوراثية للتشخيص قبل الولادة واختبار سابق للأعراض حساسة بشكل خاص.

المواد والأساليب

المرضى والتحليل الإحصائي

بالإضافة إلى ذكر سابقا SPG4 -linked الأسر (618، 624، 625، 627، 645، 4014، A، 2992، 5330، 5226، 1620، 3266، 2971 و 1001) (13، 30، 31)، 80 عائلة مع تقدمية الشلل النصفي التشنجي تم تعيينهم باستخدام المعايير التالية: وجود اثنين على الأقل من المرضى الذين يعانون من الشلل النصفي التشنجي واضح سريريا وانتقال المرض في اثنين على الأقل من الأجيال المتعاقبة. تم تصنيف المرضى وجود: (ط) الشلل النصفي التشنجي واضح، أي التشنج، وزيادة ردود الفعل والباسطة استجابة أخمصي. (ب) الشلل النصفي التشنجي المحتمل، أي زيادة فقط ردود الفعل أو الاستجابة الباسطة أخمصي. و (ج) من الممكن الشلل النصفي التشنجي، أي ردود الافعال أنشط في الأطراف السفلية مقارنة مع الأطراف العلوية. وقد عرفت بداية كسنة من ظهور الأعراض الأولى وفقا للمريض. أشكال معقدة من الشلل النصفي التشنجي فصل في خمس من هذه العائلات منذ علامات سريرية إضافية، مثل الخرف في أربع عائلات (2971، 1001، 1002 و 1010)، ومتلازمة المخيخ في قبيلة 610 وبالاعتلال العصبي في عائلة 627، تم تشخيصها في اثنين على الأقل أفراد الأسرة المصابين. تم تقييم الإعاقة على مقياس من خمس نقاط: 1، مشية عادية أو تصلب طفيفة جدا في الساقين. 2، متوسطة الصلابة مشية. 3، غير قادر على تشغيل ولكنها قادرة على المشي وحدها؛ 4، والمشي مع مساعدة؛ 5، على كرسي متحرك. أبلغت وتم الحصول على موافقة خطية من كل فرد.
تم تحديد الدلالة الإحصائية باستخدام اختبار χ 2 مع التصحيح ييتس "عند الاقتضاء، وغير المعلمية مقارنة مان ويتني U. منذ تم اختيار الأسر عن وجود عضوين على الأقل المتضررين في جيلين، استبعدت هؤلاء الأفراد من تقدير انتفاذ أن تأخذ في الاعتبار التحيز في الاختيار.

فحص التحور

وتضخمت 17 الإكسونات الترميز من SPG4 بواسطة PCR من 100 نانوغرام من الحمض النووي الجيني والتسلسل على المنظم ABI 377 (PE النظم البيولوجية التطبيقية، يزأولي، فرنسا) كما هو موضح سابقا (17). تم استخراج الحمض النووي الريبي مجموع من خطوط الخلايا lymphoblastoid المريض عندما تكون متاحة باستخدام عدة RNA PLUS (نظام Bioprobe؛ الكم Aplligene، إلكيرش، فرنسا) قد أنجز وكدنا] التوليف على ~500 نانوغرام إلى 1 ميكروغرام لكل عينة الحمض النووي الريبي مع 100 بمول من البادئات العشوائية (أمرشام فارماسيا في مجال التكنولوجيا الحيوية، ساكلاي، فرنسا) و 200 U من مرتفع الثاني RT (GIBCO BRL، لايف تكنولوجيز، روكفيل، MD) وفقا للاجراءات المتبعة. نفذت أربعة التكبير PCR التي ولدت شظايا متداخلة تغطي SPG4 إطار القراءة المفتوحة خارج على cDNAs المريض ووالتسلسل جميع المنتجات PCR على المنظم ABI 377 (PE النظم البيولوجية التطبيقية) كما ذكرت سابقا (17). تتوفر في http://www.genoscope.cns.fr كل الاشعال تستخدم لتضخيم وتسلسل كلا الإكسونات SPG4 وSPG4 كدنا]. عندما كشف تحليل تسلسل النوكليوتيدات الاختلاف في المريض، والتي تشترك في الفصل مع المرض ثم التأكد في بقية أفراد الأسرة. ، تم فحص كل من الإكسونات ثلاثة و 8 و 10 و 15، والذي تم تحديد الطفرات المحافظة في 48-62 الضوابط المحددة من الأسر CEPH.

رافت ابراهيم 11-22-2015 08:11 PM

تحليل تحور الجين spastin (SPG4) في المرضى الذين يعانون من خزل سفلي تشنجي وراثي
 
http://jmg.bmj.com/content/37/10/759.full


ملخص

BACKGROUND راثي خزل سفلي تشنجي هو شرط غير المتجانسة وراثيا. مؤخرا، تم الإبلاغ عن حدوث طفرات في الجين spastin في الأسر المرتبطة بموضع SPG4 المشترك على الصبغي 2p21-22.
الأهداف لدراسة السكان من المرضى الذين يعانون من خزل سفلي تشنجي وراثي للطفرات في الجين spastin (SPG4) على الصبغي 2p21-22.
تم تحليل طرق DNA من 32 مريضا (12 من الأسر المعروفة لتكون مرتبطة SPG4) للطفرات في الجين spastin التي كتبها ضفيرة واحدة تحليل تعدد الأشكال متعلق بتكوين والتسلسل. تم فحص جميع المرضى أيضا سريريا.
النتائج تم تحديد ثلاثة عشر SPG4 الطفرات، منها 11 رواية. وتشمل هذه الطفرات مغلطة، هراء، انزياح الإطار، والطفرات موقع لصق، ومعظمها تؤثر على كاسيت AAA. وصفنا أيضا إجراء تبديل النوكليوتيدات خارج هذه المنطقة المحفوظة التي يبدو أنها تتصرف كما طفرة المتنحية.
الاستنتاجات الطفرات المتكررة في الجينات spastin غير شائعة. وهذا يقلل من سهولة الكشف عن الطفرات كجزء من العمل حتى التشخيص المرضى الذين يعانون من خزل سفلي تشنجي وراثي. النتائج التي توصلنا إليها انعكاسات هامة على وظيفة يفترض من spastin وخطط للكشف عن طفرة في المرضى الذين يعانون HSP.
خزل سفلي تشنجي وراثي (HSP) ويضم مجموعة من الاضطرابات العصبية الموروثة. ميزة تحديد السريرية هي أقل التدريجي ضعف الأطراف والتشنج، مع ميزة المرضية شيوعا هي انحطاط مساحات القشري. 1-3 HSP غير المتجانسة وراثيا. وقد وصفت جسمية مهيمنة، راثي متنحي، وX الميراث مرتبط مع 13 مواضع التي نشرت حتى الآن، 16/04 الأكثر شيوعا طريقة الميراث يجري جسمية مهيمنة.
وقد تم التعرف على الجينات لأربعة فقط من هذه المكاني. وX اثنين من ربط أحد أشكال في SPG1 وSPG2 (نماذج نادرة من HSP فيها المرض هو أليلية مع الظروف العصبية المعقدة الأخرى) هي نتيجة لطفرات في الجينات لL1 جزيء التصاق الخلايا والبروتين شحم بروتيني، على التوالي. 4 5 A المتنحية ويتسبب الشكل من المرض مرتبط 16q24.3 الصبغي (SPG7) من خلال الطفرات في جين paraplegin، 17 لmetalloprotease الميتوكوندريا عائلة البروتين AAA (ATPases المرتبطة مع مجموعة متنوعة من الوظائف الخلوية). 18
في الآونة الأخيرة، والطفرات في رواية البروتين، spastin، وقد وصفت في سبع عائلات مع ADHSP المرتبطة بموضع SPG4 على الصبغي 2p21-22. 19 20 غالبية العائلات مع يورث HSP (40-60٪) 21 22 إظهار الربط هذا الموضع. Spastin، مثل paraplegin، ينتمي إلى أسرة البروتين AAA، على الرغم من أن هذه البروتينات يشتركان تناظر قليلا خارج عزر AAA. على عكس paraplegin وهو البروتين الميتوكوندريا، وقد اقترح spastin أن يكون توطين النووية. لا يعرف الكثير عن وظيفة spastin على الرغم من أنه مثلي للغاية ل26S proteosome الوحيدات ويمكن أن تشارك في الجمعية أو وظيفة البروتين المجمعات. 19 في هذه الورقة نفيدكم 13 الطفرات في جين spastin، بما في ذلك واحدة التي هي موجودة homozygously .
طرق

وشارك ما مجموعه 32 مريضا بريطانيا لا علاقة لها مع HSP في هذه الدراسة. اثنتا عشرة أعضاء تأثرت الأسر حيث سبق أن أظهرت الربط موضع SPG4 والباقي إما من الأسر حيث أظهر هذا المرض والنمط السائد وراثي جسمي من الميراث، ولكنها كانت صغيرة جدا لتحليل الربط، أو كانت القضية المعروفة فقط في عائلتهم. تم فحص واحد على الأقل من أفراد المتضررين من كل عائلة وتاريخ عصبي التفصيلية التي التقطها أحد مؤلفي (CMD، KW، ER).
وأجري استخلاص DNA من الدم الكامل من استخدام الإجراءات القياسية. تم تصميم كبسولة تفجير عن الكشف عن الطفرات التي كتبها ضفيرة واحدة تعدد الأشكال متعلق بتكوين (SSCP) تحليل 17 الإكسونات من الجين SPG4 باستخدام تسلسل [كدنا spastin (بنك الجينات الانضمام AJ246001) والتسلسل الجيني (بنك الجينات الانضمام AJ246003). 19 متواليات الاشعال هي هو مبين في الجدول 1.

الجدول 1
تسلسل الاشعال

تم تنفيذ PCR باستخدام درجات الحرارة الصلب لالاشعال هو مبين في الجدول 1. تم تنفيذ SSCP على نوعين من المواد الهلامية: 50٪ MDE TM (Flowgen) و 5٪ الهلام الجلسرين بنسبة 0.6٪ في TBE و 8٪ بولي أكريلاميد (49: 1 مادة الأكريلاميد: bisacrylamide) المواد الهلامية في 0.6٪ TBE. إلا أن النوع الأخير من هلام لا يسمح للكشف عن أية تغييرات من لم ينظر في هلام MDE، ولكن كان هذا الجل أفضل في فصل منتجات 1A اكسون و1B التضخيم. والتسلسل منتجات PCR تظهر التغييرات SSCP مباشرة على ABI377 DNA التسلسل. بالإضافة إلى ذلك، تم تأكيد بعض التغييرات عن طريق الاستنساخ في pGemTeasy (PROMEGA) ومتسلسلة. لكل تغيير SSCP في الكشف عن المرضى، تم فحص 100 الكروموسومات الطبيعية في ظل نفس الظروف.

النتائج

تم العثور على طفرات في الجين SPG4 في 14 عائلة، تسعة منهم كانت معروفة بالفعل أن تكون مرتبطة بموضع SPG4.
الفحص السريري للمرضى

تم فحص واحد على الأقل من أفراد المتضررين من كل عائلة. موجز للنقاط الرئيسية في تاريخ كل عائلة ومنهم من تم تحديد طفرة spastin هو مفصل أدناه في الترتيب الذي يتم عرض النتائج في الجدول 2. وتتلخص السمات السريرية لكل عائلة في الجدول 3. وقد وصفت المظاهر السريرية للعائلات C5، C7، C22، C24، C25، C27 وبمزيد من التفصيل السابق. 22

الجدول 2
طفرات جديدة في الكشف عن الجينات spastin


الجدول 3
المظاهر السريرية التي لوحظت في الأسر التي لديها طفرات الجينات spastin
N35

كان مريض واحد درست في هذه العائلة العضو الوحيد من عائلته (في السابق أو الأجيال اللاحقة، بما في ذلك أولاده الثلاثة وأحفاده 11) مع أي أعراض عصبية على الإطلاق. وقال انه اثنين sibs، أحدهم توفي عن عمر يناهز ال 39 عاما من احتشاء عضلة القلب، والآخر في سن 81 عاما من "الشيخوخة". لا كان لديه أي مشاكل في التنقل. ولم تتمكن لتشغيل، ولكن كان ذلك بدون أعراض حتى سن 60 عاما عندما بدأت تلاحظ بطء له مشية وصلابة من أطرافه السفلى مع وجود اتجاه لرحلة وصعوبة تسلق التلال. تقدمت هذه الأعراض ببطء، ولكنه بقي متنقل في سن 75 عاما. على الفحص العصبي، وقال انه قدم جوفاء خفيفة، وهو قطني قعس مبالغ فيه، ومتناظرة، خزل سفلي تشنجي متوسط ​​الشدة مع ضعف بسيط من شعور الاهتزاز في الأطراف السفلية. وأفاد درجة خفيفة من تردد البولية، ولكن كانت الأطراف العلوية العادي.
C24

وكانت المعلومات السريرية المتاحة لسبعة أعضاء المتضررين من جيلين من هذه العائلة، وجميعهم كان المظاهر السريرية النموذجية للشلل سفلي تشنجي النقي. العمر عند ظهور الأعراض تراوح 2-33 سنوات. تستخدم ثلاثة أعضاء الأسرة عصا واحدة، أعراض لمدة 30 عاما، وتستخدم كرسي متحرك. وكان أحد أفراد الأسرة تورط المثانة، يعاني أحد أفراد الأسرة من الإمساك، وآخر من الإلحاح البرازي. كان معدل تطور المرض متغير، تميل على الرغم من أن يكون بطيئا. وكان ثلاثة مرضى الطرف العلوي فرط المنعكسات. وكان ثلاثة مواضيع قدم جوفاء، وهما كان خفيفة الى معتدلة القاصي أطرافهم ضمور عضلي، وكانا قد غيرت الطرف السفلي الاهتزاز الإحساس. لم يكن أفراد الأسرة الادراكي العلني.
N4

وقد شوهدت خمسة أفراد الأسرة المصابين في هذه العائلة، ما بين 12 و 70 سنة من العمر. كان بداية في أصغر طفل قبل سن 5 سنوات، ولكن في أعضاء الأسرة من كبار السن تراوحت 20-37 عاما. باستثناء أحد أفراد الأسرة الإناث، والآن وهي في أواخر 30S، الذي يحتاج إلى كرسي متحرك في غضون ثلاث سنوات من التشخيص، كان التقدم بطيئا جدا. مشاركة الطرف العلوي هو الحد الأدنى (ردود الفعل السريع فقط في 4/5 أعضاء)، وثلاثة ديك مشاركة المثانة، والنتائج في الأطراف السفلية هي من خزل سفلي تشنجي النقي دون إضاعة أو التغيرات الحسية. يتم الإبلاغ عن أية تغييرات المعرفية في أي من أفراد الأسرة.
N5

ومن المعروف عشر موضوعات المتضررة في هذه العائلة الكبيرة، تتراوح أعمارهم بين 27 إلى 72. اثنين من أفراد الأسرة الأصغر سنا ولم يبلغ عن وجود الأعراض قبل سن 5 سنوات. كان بداية في أفراد الأسرة الأكبر سنا بين 20 و 50 عاما. لا تزال واحدة حاملة الجين تلزم بدون أعراض في 38 عاما. ثلاثة مواضيع هي مستخدمي الكراسي المتحركة، عن بعد 15 سنوات على الأقل من الأعراض. كما هو الحال مع N4 الأسرة (التي تعرف الآن لديهم نفس الطفرة، انظر أعلاه)، وكانت جميع النتائج متسقة مع خالص الشلل النصفي التشنجي وراثي، مع عدم وجود مشاكل في الادراك، على الرغم من شخص واحد قيل لديهم اضطراب الوجداني بجنون العظمة.
وأجري تشريح للخروج على عضو واحد من هذه العائلة وكانت النتائج متسقة تماما مع خالص HSP، تظهر أمراض تقتصر على مساحات القشري. أعلنت وشحوب المايلين وفقدان المحاور خصوصا في مساحات القشري الجانبي وبطني. وكانت خسارة المايلين في العمود الظهري الأبرز في الحبل الشوكي العنقي، ولكن مسارات القشري في السويقة المخية تم الحفاظ عليها بشكل جيد.
N3

معلومات قليلة نسبيا متاح في هذه العائلة. ومع ذلك، ذكرت بداية في جميع المواد حيث تم تسجيل هذا كان قبل سن 5 سنوات. شخص واحد يحتاج إلى كرسي متحرك.
N2

تم الإبلاغ عن هذه العائلة سابقا. 23 وكان ظهور المرض في الجيل الأصغر في العامين الأولين من الحياة والمراهقين في وقت متأخر من الأجيال السابقة. في لكن كل واحد من أفراد الأسرة، والنمط الظاهري يتفق مع خالص HSP. ومع ذلك، كان واحدا من أفراد الأسرة الأكبر سنا تاريخ من التدهور المعرفي التدريجي في العامين قبل وفاته. أظهر تشريح تاو منتشر التغييرات القشرية ذات الصلة. وكان أفراد الأسرة المتضررين آخر مشكلة المعرفية لديهم ضعف معمم التعلم اللفظي، والتعلم غير اللفظية، والذاكرة، والكشف عن مشاكل في التعلم في مرحلة الطفولة. أهمية هذه الصعوبات لها HSP غير معروف.
C27

تم فحص تسعة أعضاء المتضررين من ثلاثة أجيال من هذه العائلة. العمر عند ظهور الأعراض تراوح من 10 سنوات إلى 29 سنة. وكانت موضوعين المتضررة سريريا أعراض تتراوح أعمارهم بين 23 و 25 عاما. وكان معدل تطور المرض متغير، على الرغم من أن تميل إلى أن تكون بطيئة. موضوع واحد تحتاج إلى عصا المشي وثلاثة، وكلها أعراض لأكثر من 30 عاما، استخدام كرسي متحرك. وكان خمسة مرضى مشاركة المثانة وثلاثة من هذه اللازمة القسطرة البولية. عانى ثلاثة مرضى من الإمساك وهما من المواضيع الذكور عاجز. وكان ستة موضوعات الطرف العلوي فرط المنعكسات. وأظهر فحص أطرافهم السفلى علامات نموذجية من خزل سفلي تشنجي في جميع الحالات. وكان ستة مواضيع تشوه القدم، وكان واحد معتدل البعيدة أقل الهزال أطرافه، وكان الثلاثة في غياب الطرف السفلي الاهتزاز الإحساس. لم يكن أفراد الأسرة الادراكي العلني.
C5

تم فحص ثمانية أعضاء المتضررين من ثلاثة أجيال. كان العمر عند ظهور الأعراض تتراوح بين 5 و 50 عاما، وأحد أفراد الأسرة المتضررين عديمة الأعراض في سن 28 عاما. مطلوب اثنين من أفراد الأسرة عصا المشي وأحد أفراد الأسرة، أعراض لمدة 47 عاما، استخدام كرسي متحرك. وكان معدل تطور المرض متغير، على الرغم من كان بطيئا بشكل عام. كان تورط المثانة الحالي في ثلاث مواد، مع واحد تتطلب القسطرة سكنى، وعانى خمسة من أفراد أسرة من الإمساك. تم العثور على علامات نموذجية من الطرف السفلي خزل سفلي تشنجي في جميع المواد المتضررة. وكان أربعة من أفراد أسرته الطرف العلوي فرط المنعكسات، وكان خمسة موضوعات قدم جوفاء، وكان اثنان معتدل البعيدة أقل ضمور عضلي أطرافهم. وكان خمسة من أفراد أسرة انخفضت انخفاض الإحساس أطرافهم الاهتزاز واثنين قد تضاءلت الطرف السفلي الإحساس بالألم. ولم ترد تقارير عن ضعف الادراك العلني في أي من أفراد الأسرة. عانى ثلاثة من أفراد الأسرة أيضا من تنكس المشيمية، الذي فصل في الأسرة بشكل مستقل عن HSP.
N36

واعتبر عضو واحد فقط من هذه ثلاثة أجيال العائلة، وكان بداية مرضه في 40 عاما. وكانت حالة ببطء تدريجي وبعد مرور 12 عاما انه لا يزال متنقل. الفحص السريري يتسق مع HSP النمط الظاهري الخالص، مع بعض الهزال القاصي والحسية خسارة طفيفة على ما تستهلكه والاهتزاز في أطرافه السفلى. أظهر اختبار Neuropsychometric ضعف خفيف من التعلم اللفظي. يعقد تقييمه هو تاريخ من شلل الأطفال والسل التهاب السحايا في مرحلة الطفولة. والدته، الذي كان يفترض من التاريخ أن تتأثر مع HSP، وكان الخرف يصيب في وقت متأخر، كما فعل خالة.
C7

شوهد ستة أفراد الأسرة المتضررين من جيلين من هذه العائلة. العمر عند بداية للمرضى أعراض تراوح 2-37 سنوات، وكان موضوع المتضررين واحد بدون أعراض في 22 عاما. استخدام أحد أفراد الأسرة العصي واثنين، وكلاهما أعراض لأكثر من 20 عاما، وتستخدم كرسي متحرك. وكان معدل تطور المرض متغير، تميل على الرغم من أن يكون بطيئا. وكان ثلاثة من أفراد الأسرة تورط المثانة. وكان خمسة من أفراد أسرة كانت النتائج العلوي فرط المنعكسات الأطراف وأقل فحص أطرافهم نموذجية من خزل سفلي تشنجي موجودة في جميع الحالات. وكان اثنين من المرضى تشوهات القدم واحدة قد تضاءلت أقل اهتزاز الأطراف وإحساس مشترك الموقف. وذكر أيا من الموضوعات التي لديها ضعف الادراك.
C22

تم فحص خمسة أفراد الأسر المتضررة من جيلين من هذه العائلة. العمر عند بداية للمرضى أعراض تراوح 2-30 سنوات، وكان موضوع المتضررين واحد بدون أعراض في 23 عاما. مطلوب واحد من أفراد الأسرة عصا المشي على الرغم من أن لا شيء يلزم على كرسي متحرك. وكان ثلاثة من أفراد الأسرة تورط المثانة واشتكى أحد من الإمساك. معدل تطور المرض تميل إلى أن تكون بطيئة، على الرغم من أن المتغير. وكانت نتائج الفحص السريري نموذجية من خزل سفلي تشنجي موجودة في جميع الحالات. وكان أحد أفراد الأسرة الطرف العلوي فرط المنعكسات، كان ثلاثة مواضيع قدم جوفاء، وكان ثلاثة مواضيع غيرت مسة غرامة، والاهتزاز، أو مشترك الإحساس الموقف. لم يتم الإبلاغ عن ضعف الادراك في أي من أفراد الأسرة.
N37

هذا المريض هو القضية المعروفة فقط من HSP في عائلته. كان المرض بداية في 11 عاما، وكان ببطء شديد تقدمية. العلامة الوحيدة على المرض في الأطراف العلوية هي ردود الفعل وتر سريعة. في الأطراف السفلية، لديه ضعف القاصي معتدل درجة الحرارة والاهتزاز الإحساس. لديه مشكلات في الحالة المزاجية، ولكن لا الميزات الأخرى المرتبطة بها.
C25

تم فحص اثني عشر عضوا المتضررين من ثلاثة أجيال من هذه العائلة. العمر عند ظهور الأعراض تراوح 16-41 سنة، وكان موضوع واحد مع وجود علامات على الفحص بدون أعراض في 30 عاما. أربعة من أفراد الأسرة تحتاج إلى عصا المشي وخمسة، كل أعراض لمدة 30 سنوات على الأقل، مطلوب على كرسي متحرك. وكان خمسة مرضى مشاركة المثانة، مريض واحد يعاني من الإمساك، وآخر من الإلحاح البرازي. وكان معدل تطور المرض متغير، ولكن بطيئة عموما. وكان اثنين من المرضى خفيف الطرف العلوي فرط المنعكسات، في واحدة مصحوبة طفيف ضعف الطرف العلوي. في جميع الحالات كانت هناك علامات نموذجية من خزل سفلي تشنجي في الأطراف السفلية. وكان ستة مرضى قدم جوفاء وثلاثة عبوة الحزاز. خفيفة الى معتدلة أقل ضمور عضلي أطرافهم كان حاضرا في ثلاث حالات. وكان سبعة مرضى الطرف السفلي تشوهات الحسية، التي تنطوي على اتصال جيد، والإحساس بوخز أو الشعور موقف مشترك. وكان أحد أفراد الأسرة المتضررين الذين تتراوح أعمارهم بين 80 الخرف يصيب الراحل، على الرغم مزيد من التفاصيل السريرية حول هذه غير متوفرة.
N8

شوهد اثنين من أفراد الأسرة المتضررة سريريا. واحد 70 سنة حاملة الجين القديم هو غير متناظرة. وكان كل أفراد الأسرة المصابين ظهور المرض في 40 عاما، واحدة يتطلب على كرسي متحرك بعد سنوات عديدة. جميع المواد لها القاصي تلف العضلات وقدم جوفاء. ولم ترد أنباء عن تورط المثانة. في أحد أفراد العائلة المتضررين 86 سنة، كان هناك تاريخ أربع سنوات من الخرف التدريجي مع معتدل الصعوبات كلمة الحقائق وعلامات إطلاق الفص الجبهي على اليمين. أم لا هذا يتعلق مضاعفات HSP لها أو له علاقة عملية المرض من قبيل الصدفة آخر لم يثبت على وجه اليقين.
التحليل الجيني

باستخدام التحليل SSCP حددنا 13 طفرات جديدة في الجين SPG4. لم يكن أي من هذه الطفرات موجودة في لوحة التحكم من 100 الكروموسومات الطبيعية. كان واحد فقط من هذه الطفرات (859C> G) موجودة في أكثر من عائلاتنا. لم تكن معروفة من العائلتين N4 وN5 لتكون ذات صلة، ولكن على حد سواء الأسر تنبع من نفس المنطقة من انجلترا ولها نفس النمط الفرداني للعلامات D2S2203 وD2S2347 جانبي الجين SPG4، والتفسير الأكثر احتمالا هو أن كلا من سهم الأسر سلف مشترك.
اثنين من الطفرات 1298 + 1G> لو+ 1538 3del (aagt) وقد وصفت من قبل Fonknechten وآخرون 20 والطفرات المتبقية هي رواية.
معظم الطفرات (7/13) هي الطفرات لصق، وكلها تؤثر على موقع لصق المانحة. ومن المتوقع أن يؤدي إلى اكسون الطفر من اكسون السابقة هذه الطفرات، وسوف يؤدي إلى انزياح الإطار في التسلسل المتبقية، ما عدا في حالة من الطفرة التي تنطوي على اكسون 8 (المريض N3). ومن شأن كل هذه الطفرات تؤدي إلى اضطراب شديد في عزر AAA الحفاظ عليه.
ثلاث طفرات (859C> G، 411delG، و1406delT) تؤدي مباشرة أو غير مباشرة لوقف كودون سابقة لأوانها، وسوف تؤدي إلى إنتاج بروتين اقتطاع.
الطفرات مغلطة اللذين تتصرف بطريقة المهيمنة وكلاهما يقع في المنطقة كاسيت AAA الحفظ وكلاهما يؤثر على الأحماض الأمينية التي يتم حفظها للغاية بين spastin والبروتينات ترتبط ارتباطا وثيقا. 19 وطفرة في الأسرة N2 محل أرجينين، وهو حمض أميني أساسي مع الجلايسين ، وهو أصغر بكثير ومحايد. طفرة في N8 محل حمض الأسبارتيك، وهو من الأحماض الأمينية الحمضية مع الحامض الاميني، وهو حمض أميني أساسي مع سلسلة الجانب العطرية. يبدو من المرجح أن هذه التغييرات من شأنها تقلل بشدة أو تلغي وظيفة البروتين. هناك ما يميز هؤلاء المرضى ظاهريا من ذوي الطفرات هراء / لصق. عمر البدء متأخرا (40) في N8 الأسرة، ولكن كما يتبين من الجدول سن العام من بداية في هذه الأسر هو متغير جدا حتى داخل الأسرة. في كل من الأسر N2 و N8، وقد وصفت عضو من كبار السن الذين يعانون من الخرف، رغم أن هذه كانت موضوع واحدة في كل أسرة فقط.
كان المريض N35 متماثل (الشكل 1) لطفرة في اكسون 1 والتي تحل محل سيرين (حمض أميني قطبي) في موقف 44 مع يسين، وهو حمض أميني غير القطبية. وأكد العثور على التغيير متماثل باستخدام مجموعة مختلفة من الاشعال، وهذه المرة exonic تماما. تكرار تسلسل هذا المنتج تنتج نفس النتيجة. كان والدا هذا المريض ميتا، ولكن أيا منهما لم تظهر أي أعراض الشلل النصفي التشنجي في حياتهم. تم الإبلاغ عن المريض sibs والأطفال والأحفاد أيضا أن تكون خالية من المرض. ولم تعرف والدي المريض أن يكون ذو قربى، ولكن التفسير الأكثر ترجيحا هو أن كل أليل جاء من نفس المؤسس. وأظهر تحليل النمط الفرداني من العلامات المرافقة أن أقرب اثنين علامات، D2S2203 وD2S2351 على الجانب telomeric من الجين spastin، كان متماثل كما هو متوقع، في حين أن أقرب علامات على الجانب القسيم المركزي، D2S2325 وD2S2347، كان متخالف. هذه العلامات الأخيرة، ولكن، بعيدا عن الجينات spastin على خريطة المادية 24 وrecombinants بين هذه العلامات والجينات spastin وقد سبق لاحظت. كان هذا المريض من شمال شرق إنجلترا، كما كانت الكروموسومات مراقبة 100 تستخدم للتحقق من وجود هذه الطفرة في عدد السكان غير HSP. لم يتم العثور على عينات أخرى لهذا التغيير، لذلك نحن نعتقد أن هذا من المرجح أن يكون المرض المرتبطة تسلسل تغيير يتصرف بطريقة المتنحية. Fonknechten وآخرون 20 أيضا لا توجد الأشكال في أي الإكسونات من الجين spastin في 142 مواضيع تحليلها.
http://jmg.bmj.com/content/37/10/759/F1.medium.gif
الشكل 1
SSCP وتسلسل تحليل المريض N35. (A) منتجات اكسون 1A PCR من N35 وطبيعية عينة من الحمض النووي S1 التالية الكهربائي على هلام بولي أكريلاميد (فضية الملون). لاحظ وجود غير طبيعي وعدم وجود العصابات العادية في المريض N35. (B) تسلسل المباشر الجزئي للمنتج PCR اكسون 1A لN35 وS1 العينة الضابطة، وتبين أن N35 غير متماثل للT في موقف 256.

نقاش

وقد أظهرت التحليل الجزيئي للجينات لspastin في هذه اللوحة من المرضى HSP البريطاني 13 الطفرات، 11 منهم رواية. كان اختبار (باستثناء عائلتين ربما يكون منشؤها من سلف مشترك) لكل عائلة طفرة مختلفة. وهذا يؤكد أن الكشف عن الطفرات في هذا الجين في المرضى الذين يعانون من الشلل النصفي التشنجي ستكون مهمة أكثر صعوبة مما لو كان قد تم تحديد عدد أقل من الطفرات المتكررة. 19 وما يزيد من تعقيد هذه المهمة، لدينا أدلة على أن ليس كل الطفرات SPG4 قد يتم الكشف عن استخدام هذه تقنيات الكشف عن الطفرات الروتينية، كما لم يتم العثور على طفرات في ثلاث عائلات حيث تم أظهرت الربط موضع SPG4. هذا العائد ناقصة من الطفرات حتى في الأسر التي يعرف أنها ترتبط إلى وأفيد أيضا عن طريق Fonknechten وآخرون موضع SPG4 23 في دراستنا، وهذا قد يعكس القيود المفروضة على SSCP الذي يكتشف بصورة روتينية فقط ما يقرب من 80٪ من الطفرات. بدلا من ذلك، فإنه قد يعني أن تسلسل خارج تحتاجه المنطقة الترميز لدراستها، مثل موقع المروج أو تذييل بعديد الأدينيلات. وهناك احتمال آخر، خصوصا أن الكثير من الطفرات وصفها حتى الآن يؤثر على الربط، يمكن أن يكون هذا التسلسل يتغير في إنترونات لم يتم الكشف عن استخدام هذه مجموعات من الاشعال قد تسبب المرض من خلال تفعيل وintronic لصق موقع خفي. ومن غير المعروف بعد ما اذا كانت توجد أشكال تقسم بدلا من spastin، التي يحتمل أن تحتوي على تسلسل اكسون إضافية، كما لم تصور النصوص RNA التي النشاف الشمالي، وذلك بسبب وفرة منخفضة. 19 وفي دراسة مستقلة سبقت تورط هذا الجين في HSP، تم عزل كدنا] spastin من الدماغ عن طريق Kikuno وآخرون 25 والبروتين المسمى KIAA1083. هذه النسخة كدنا] يفتقر اكسون 4، ولذلك فمن الممكن أن المتغيرات مزيد من لصق لا تزال تتسم.
درس عدد من الطفرات المختلفة الموجودة، جنبا إلى جنب مع العائد المنخفض من الطفرات في الأسر الصغيرة وحالات متفرقة، تشير أيضا إلى أن الكشف عن الطفرات في spastin قد لا يكون في حد ذاته وسيلة منطقية إلى الأمام من أجل التشخيص الجزيئي في HSP لبعض الوقت. وبالإضافة إلى ذلك، فإن المظاهر السريرية وصفها في هذه الأسر التي لديها طفرات spastin لا توفر أدلة كثيرة مفيدة للكشف عن أي من المرضى سريريا لاستهداف لتحليل الطفرة spastin. وقد HSP تصنف تقليديا إلى "النقي" والأشكال "معقدة" اعتمادا على ما إذا التشنج هو السمة الوحيدة أو ما إذا كانت هناك أعراض أخرى، مثل الصرع، والخرف، أو ترنح. 26 وكان معظم الأسر التي لديها طفرة في spastin على HSP النقي النمط الظاهري، مع اختلاف ملحوظ في العمر عند بداية وشدة المرض، على الرغم من المرض عموما معتدل نسبيا كان المعيار. من 66 المواضيع المتضررة فحص أو يعرف من في هذه الأسر، والمطلوب 18 فقط على كرسي متحرك، أكثر في مراحل متأخرة من المرض. علامات طفيفة فقط (ردود الفعل السريع) وعادة ما توجد في الأطراف العلوية، مع التغيرات الحسية اكتشفت في الأطراف السفلية في أقلية من المرضى. كان تورط المثانة متغير. أهمية تقارير التدهور المعرفي، مشاكل المزاج، أو الاضطرابات العاطفية في أفراد الأسرة في بعض الأحيان من الصعب تقييم. تاريخ بداية الخرف في وقت متأخر من N2 الأسرة أكثر وضوحا، ويتوافق مع التقارير السابقة من مشاكل في الادراك في الأسر SPG4. عموما، ومع ذلك، وفقا لتقارير سابقة الربط مقرها، 21 فمن الصعب أن نتبين ملامح محددة من شأنها أن تؤدي إلى الشك السريري للمشاركة spastin في حالة واحدة.
ومن المتوقع أن غالبية الطفرات الكشف حتى الآن في SPG4 أن يؤدي إما بروتين اقتطاع أو بروتين تغير بشدة، مؤكدا أن haploinsufficiency هو السبب في النمط الظاهري غير طبيعي. وتمثل طفرات الموقع وصلة لسبعة من أصل 13 الطفرات التي وجدنا ويقال هذا تيرة عالية من لصق الطفرات الموقع أيضا Fonknechten وآخرون. 20 واثنين من الطفرات مغلطة المهيمنة نفيدكم تؤثر الأحماض الأمينية في المجال AAA الحفاظ مشتركة مع 11 الطفرات مغلطة وصفها Fonknechten وآخرون، 20 مما يدل على أن هذه المنطقة هي حاسمة لوظيفة البروتين.
طفرة مغلطة في اكسون 1، وهو خارج عزر AAA الحفظ، موجود homozygously في المريض درسنا. هذا المريض ليس لديه أقارب المتضررة مع HSP. سريريا، لديه مرض خفيف جدا مع المتأخر. كان هذا التغيير تسلسل غير موجود في عدد السكان سيطرتنا. لسوء الحظ لم تكن هناك أعضاء آخرين من هذه العائلة المتوفر للدراسة. شريطة أن هذه ليست تعدد الأشكال النادرة مع المظاهر السريرية للHSP في هذا الشخص وجود سبب بديل، وهذا هو أول طفرة متنحية في spastin إلى وصفها. راثي مقهور HSP (ARHSP) هي العائلات النادرة والأقارب ترتبط الكروموسومات 8Q، 16q، ولقد وصفت 15q، 12-14 ولكن حتى الآن لم أسر مع الربط إلى مكان SPG4. هذه الطفرة، التي تحل محل سيرين مع بقايا يسين في موقف 44، هي في الجزء المبكر من البروتين، وهي المنطقة التي يظهر الحفظ كبير بين spastin والبروتينات ذات الصلة. 19 وفي الواقع، في وثيقة الصلة بروتين الخميرة SAP1، هناك ليسين في هذا الموقف. الفرضية الأكثر احتمالا هي أن هذه الطفرة يتصرف باعتباره ناقص المفعول، الأليل الذي ينتج المبلغ المخفض أو نشاط من المنتجات. إذا كان هذا التحول هو فقط على أليل واحد، لا يتم تقليل كمية spastin بما يكفي للتسبب أعراض، ولكن الموضوعات مع نسختين من أليل متحولة يكون غير كاف spastin. وقد تم بالفعل اقترح إمكانية أن "تأثير العتبة" لمستويات spastin قد تكون حاسمة. 23 وإذا كانت هذه التخمينات صحيحة، فإن هذا يمثل تفسيرا غير عادي من آثار السائدة والمتنحية من الطفرات المختلفة في نفس الجين. تم مؤخرا افترض هذه الفرضية أيضا لشرح الطفرات السائدة والمتنحية في الجينات connexin31 27 (جينة تسبب فقدان السمع غير متلازمات)، على الرغم إذ كانت كل من الطفرات السائدة والمتنحية في هذا الجين مغلطة انه ليس من الواضح ما إذا كانت الطفرات السائدة تسببت في المرض من خلال haploinsufficiency أو الآثار السلبية المهيمنة. إذا كان هذا الأخير هو الحال ثم الطفرات المتنحية في هذا الجين من المحتمل أن تكون الطفرات فارغة. اكتشاف طفرة المتنحية على ما يبدو في SPG4 يعني أن هذا البروتين يجب يحتمل أن ينظر في المرضى الذين يعانون من ARHSP وكذلك مرض المهيمن. سيكون من المثير للاهتمام أن نرى ما اذا كان يتم اكتشاف الطفرات المتنحية الأخرى، وإذا كانت هذه الخريطة إلى الجزء الأول من هذا الجين. قد توفر مثل هذه الطفرات خيوط مهمة لوظيفة البروتين التشنجي.

رافت ابراهيم 11-22-2015 08:18 PM

الطفرات في spg11 متكررة في راثي شلل سفلي تشنجي المتنحية مع رقيقة الجسم الثفني، التدهور المعرفي وانخفاض العصبون الحركي انحطاط
 
http://brain.oxfordjournals.org/content/131/3/772.full

لملخص

paraplegias تشنجي وراثي (HSP) هي أمراض العصبية تتميز بشكل رئيسي عن انخفاض التشنج الأطراف المرتبطة بها، في أشكال معقدة، مع علامات عصبية إضافية. قمنا بتحليل سلسلة كبيرة من المرضى مؤشر = 76) مع هذا الشرط، سواء من الأسر التي لديها الميراث راثي متنحي = 43) أو المرضى المعزولين = 33)، لطفرات في الجين SPG11 حددت مؤخرا. لقد وجدنا 22 الطفرات مقطوعة، بما في ذلك أول أربع طفرات الموقع لصق، فصل في سبع حالات معزولة و13 عائلة. وكانت تسعة عشر طفرات جديدة. تم العثور على اثنين من الطفرات المتكررة في المرضى الذين يعانون البرتغالية وشمال أفريقيا مشيرا إلى الآثار مؤسس في هؤلاء السكان. تردد طفرة تختلف باختلاف النمط الظاهري، من 41٪، في المرضى الذين يعانون HSP عرض مع الجسم الثفني رقيقة (TCC) التي تصور MRI، إلى 4.5٪، في المرضى الذين يعانون من الضعف العقلي دون TCC. وقعت المرض بداية أثناء أول من العقد الثالث أساسا من مشاكل مع مشية و / أو التخلف العقلي. بعد مدة مرض متوسط ​​14.9 ± 6.6 سنوات، كان النمط الظاهري من 38 SPG11 المرضى شديدة مع 53٪ من المرضى ملزمة على كرسي متحرك أو طريح الفراش. بالإضافة إلى التخلف العقلي، أظهرت 80٪ من المرضى الذين يعانون من ضعف التدهور المعرفي التنفيذي. ومن المثير للاهتمام، والنمط الظاهري شملت أيضا في كثير من الأحيان أقل تنكس الخلايا العصبية الحركية (81٪) يعانون من الهزال (53٪). ولوحظت علامات المخيخ العين طفيفة أيضا في المرضى الذين يعانون من مرض فترات طويلة. بالإضافة إلى TCC (95٪)، وكشف الدماغ MRI التعديلات البيضاء المسألة (69٪) وضمور القشرية (81٪)، والتي تفاقمت مع مدة المرض. في الختام، دراستنا تكشف ارتفاع وتيرة الطفرات SPG11 في المرضى الذين يعانون من HSP، وهو TCC وضعف الادراك، بما في ذلك المرضى المعزولين، وتمتد النمط الظاهري المرتبطة بها.
  • paraplegias تشنجي
  • SPG11
  • رقيقة الجسم الثفني
  • اعاقة عقلية
  • أقل العصبون الحركي انحطاط
مقدمة

paraplegias تشنجي وراثي (HSP) هي الظروف العصبية التي المظاهر السريرية الرئيسية هي التشنج التدريجي وضعف الأطراف السفلية المرتبطة العمود الخلفي أو تورط المثانة (هاردينغ، 1983؛ Filla وآخرون، 1992؛. Tallaksen وآخرون، 2001) . هذا النمط الظاهري يمكن أن يكون معقدا بسبب وجود مجموعة واسعة من العلامات أو الأعراض العصبية وغير عصبية إضافية بما في ذلك التخلف العقلي والصمم، رنح مخيخي، والصرع، ورتة، السماك، ضمور العصب البصري، الاعتلال العصبي المحيطي، التهاب الشبكية الصباغي، الساد، الخ ورثت هذه الأمراض في جسمية مهيمنة، راثي متنحي (AR) أو X-ترتبط بطريقة وتم أظهرت التباين الوراثي واسعة مع تحديد أكثر من 33 مواضع و 15 جينات (فينك، 2006؛ المنان وآخرون، 2006؛ فالدمانس وآخرون، 2007؛. Stevanin وآخرون، 2007). هي سبب الأشكال الأكثر شيوعا من راثي HSP المهيمن، وهو ما يمثل حوالي 50٪ من المرضى، من خلال الطفرات في SPG4 وSPG3A الجينات التي تشفر لspastin وatlastin، على التوالي (حزان وآخرون، 1999؛ تشاو وآخرون، 2001) .
في AR-HSP، لوحظ بشكل متكرر أكثر من راثي HSP المهيمن في السكان الفطرية (كوتينهو وآخرون، 1999)، والجينات الثلاثة الأولى المحددة التي ترميز paraplegin (SPG7)، spartin (SPG20) وmaspardin (SPG21) (Casari وآخرون. ، 1998؛ باتل وآخرون، 2002؛ سيمبسون وآخرون، 2003)، فضلا عن الجين المسؤول عن ترنح التشنجي ذات الصلة شرلفويإكس ساجوينى (Engert وآخرون، 2000)، تمثل نسبة صغيرة فقط من جميع حالات ( فينك، 2003). لافت للنظر، وثلث المرضى حول مؤشر AR-HSP لها الجسم الثفني رقيقة أو ضمرت (ARHSP-TCC) التي تصور MRI مع درجات مختلفة من العجز المعرفي (فرانكا وآخرون، 2007). تم تعيين هذا النوع من AR-HSP في البداية لكروموسوم 15q13-15 [SPG11، (مارتينيز وآخرون، 1999 وتستأثر 41-77٪ من الأسر أفادت ARHSP-TCC (Shibasaki وآخرون،)]. 2000؛ كازالي وآخرون2004؛ Stevanin وآخرون، 2006). في الآونة الأخيرة، والجينات SPG11، المعروف أيضا باسم KIAA1840 / FLJ21439، الذي يشفر spatacsin، تم تحديد وتحور في 11 من 12 مريضا مؤشر ARHSP-TCC (Stevanin وآخرون، 2007). وقد تم تحديد عشرة طفرات مختلفة في الأسر 11. كانوا إما هراء الطفرات والحذف أو الإدراج في تسلسل الترميز SPG11، مما أدى نظريا في البروتين اقتطاع بشكل غير طبيعي في جميع الحالات.
وكانت أهداف هذه الدراسة لتقدير وتيرة SPG11 الطفرات في سلسلة كبيرة من المرضى الذين يعانون من ARHSP مع أو بدون TCC، والتخلف العقلي أو ضعف الادراك، لتحديد الطيف من الطفرات في هذا الجين ووصف الظواهر المرتبطة بها.

المواد والأساليب

المواضيع

وقد تم اختيار ثلاثة وأربعون قبيلة مثل الميراث مقهورة و 33 حالات معزولة وليس لهم تاريخ عائلي للمرض و 22 و 5 منها الأقارب، على التوالي. المرضى مؤشر قدمت مع إما (ط) الشلل النصفي التشنجي مع تخلف عقلي أو ضعف الادراك وTCC تصور في التصوير بالرنين المغناطيسي = 26)، (ب) الشلل النصفي التشنجي مع TCC دون التخلف العقلي والادراكي = 11) أو (ج) الشلل النصفي التشنجي مع تخلف عقلي أو ضعف الادراك دون TCC = 22). بالإضافة إلى ذلك، المرضى المؤشر 17 عرض مع الشلل النصفي التشنجي والتخلف العقلي أو الإعاقة الإدراكية التي MRI لم تكن متاحة حللت أيضا. وقد اعتمدت هذه الدراسة من قبل لجنة أخلاقيات المحلية (موافقة أي 03-12-07 من COMITE الاستشاري لصب لا حماية قصر Personnes ET LA بحوث Biomédicale باريس نيكر إلى الدكاترة A. الدر وA. بريس). وقد أعطيت موافقة خطية أبلغت من قبل جميع الأعضاء المشاركين في الأسر قبل جمعت عينات الدم لاستخراج الحمض النووي. أجريت جميع التقييمات السريرية وفقا للبروتوكول التي وضعتها الشبكة الأوروبية والمتوسطية لالإنحطاط مخيخي شوكي (SPATAX، المنسق: الدكتور A. الدر) التي شملت: التاريخ الطبي الكامل والفحص، تقدير العمر عند بداية من قبل المريض، وجود أو غياب إضافية الأعراض العصبية / علامات، electroneuromyographic (ENMG) دراسات والتصوير بالرنين المغناطيسي الدماغ عندما يكون ذلك ممكنا. IQ أو البسيطة العقلية الدولة التقييمات (MMSE) (Folstein وآخرون، 1975) كانت متوفرة ل 12 مريضا، اثنان منهم كان التقييمات النفسية العصبية مفصلة بما في ذلك معيار مصفوفات [PM38، (الغراب، 1982)] والذاكرة وكسلر مقياس (وكسلر ، 1987). وفقا لمعايير DSM-IV (التشخيص والدليل الإحصائي للاضطرابات العقلية، 2000، اعتبر التخلف العقلي) عندما كان المريض كان معدل ذكائهم <70 قبل سن 18 عاما.
كان معظم المرضى الفرنسية = 37) أو شمال أفريقية = 15)، أو نشأت من البلدان الأوروبية الأخرى = 13) والشرق الأوسط = 6) وغيره = 5). أحد عشر من 33 موضوعات متفرقة اختبارها سابقا السلبي للطفرات أو إعادة ترتيب في الجين SPG4 (Depienne وآخرون، 2006، 2007)؛ تم استبعاد طفرات في الجين SPG7 أيضا في مجموعة فرعية = 20/43) من أسرة (Elleuch وآخرون، 2006).
التنميط الجيني

تم التحقيق الربط SPG11 في 33 عائلة AR-HSP باستخدام علامات متعددة الأشكال D15S781، D15S537، D15S516 وD15S659 بعد تضخيم الحمض النووي التي تفاعل البلمرة المتسلسل (PCR). والحجم وamplicons على المنظم ABI بريزم 3730 الآلي مع برنامج GenMapper (النظم البيولوجية التطبيقية، فوستر سيتي، كاليفورنيا، الولايات المتحدة الأمريكية)، كما هو موضح سابقا (Stevanin وآخرون، 2006). بعد إعادة الإعمار النمط الفرداني، وقد تم تأسيسها الربط المفترض على أساس النسخ المتنوعة المشتركة عن النسب في أقارب المتضررة من نفس النسب.
الكشف عن الطفرات

وتضخمت حدود تسلسل الترميز ولصق موقع من 40 الإكسونات من الجين SPG11 بواسطة PCR والتسلسل في كلا الاتجاهين كما هو موضح سابقا (Stevanin وآخرون، 2007).
تم إجراء ترقيم الطفرات الجديدة / الأشكال نسبة إلى ATG كودون من اكسون الترميز الأول، على النحو الموصى به من قبل الجمعية الجينوم الاختلاف الإنسان (http://www.hgvs.org/mutnomen/). تم التحقق من الفصل بين الطفرات / الأشكال مع المرض عن طريق التسلسل المباشر في 64 أفراد الأسرة الإضافية التي كانت متوفرة عينات من الحمض النووي. بالإضافة إلى ذلك، تم فحص الاشخاص الاصحاء لا علاقة لها تقييم وتيرة التغييرات nucleotidic: 80 الفرنسية القوقازيين، 31 الشمال والأفارقة، 103 فلسطينيا و 48 فردا من الأرجنتين. تم تقييم مرادفة، مغلطة ولصق موقع اختلافات منهجية لإدخال تعديلات على الأكسون exonic splicing enhancers (خوارزمية ESEfinder المتاحة في http://www.rulai.cshl.edu/cgi-bin/tools/ESE/esefinder.cgi) أو تسلسل الربط التوافق(at http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html and http://www.fruitfly.org/seq_tools/splice.html ). تم إجراء محاذاة متعددة مع orthologs spatacsin في الأنواع المختلفة باستخدام ClustalW البرمجيات (http://www.ebi.ac.uk/clustalw/) لتقييم الحفاظ على المتغيرات مغلطة.
التأثير على مرنا الربط من البديل تؤثر على كودون الأخيرة من اكسون 15 تم تحليلها من قبل RT-PCR RNA على المستخرجة من الابيضاض اللمفاوي المريض FSP670-5، كما ذكرت في مكان آخر (Stevanin وآخرون، 2007) باستخدام بادئات cDNAF-GCTCTGTGGTGGGATCAACT ( اكسون 14) وcDNAR-TGCTTACACTGGCCTGATTG (اكسون 18) في درجة حرارة التلدين من 60 درجة مئوية، تليها التسلسل المباشر من المنتج PCR.

النتائج

دراسات الربط

قمنا بتحليل البداية الفصل بين المرافقة أربعة من الواسمات الوراثية بإحكام الجين SPG11 في 33 قبيلة، حيث تم أخذ عينات اثنين على الأقل من المرضى المتضررين. تم استبعاد اثني عشر عائلات لأنه لا يوجد النسخ المتنوعة المشتركة فصلت مع المرض في أقارب المتضررة. في 21 الأسر (64٪)، وإعادة بناء النسخ المتنوعة متوافق أو لم يستبعد الربط SPG11. في هذه الأسر 21، والتسلسل الجين SPG11.
SPG11 طفرة الفحص

تم تنفيذ التسلسل المباشر لهذا الجين SPG11 في 64 مريضا مؤشر لا علاقة لها، بما في ذلك probands من الأسر المرتبطة مزعومة 21 المذكورة سابقا والمرضى 43 مؤشر لا تحليلها من قبل دراسات الربط. حددنا 22 الطفرات اقتطاع في المرضى مؤشر من 20 عائلة، 19 متغيرات تم التعرف حديثا (الجدول 1). في 14 من هذه العائلات، كانت الطفرات متماثل. في ست قبائل، وكان المرضى اثنين من الطفرات متخالف مجمع. فصلت ما بين الطفرات مع المرض في الأسر حيث يمكن اختبار هذا (الشكل التكميلي). أقارب تتأثر = 47) لم يكن لديه اثنين من طفرات في الجين SPG11.

الجدول 1
الطفرات SPG11
أسرة وراثة زواج الأقارب الأصل اكسون / إنترون طفرة (ق) متماثل الطفرات غير المعنى FSP831 AR نعم فعلا البرتغال Exon3 c.529_533delATATT، p.I177SfsX178 SPD199 AR نعم فعلا ديك رومي Exon4 c.704_705delAT، p.H235RfsX246 FSP870 AR نعم فعلا تونس Exon4 c.733_734delAT، p.M245VfsX246 FSP393 AR نعم فعلا البرتغال Exon6 c.1235C> G، p.S412X FSP838 معزول نعم فعلا المملكة العربية السعودية Exon30 c.5769delT، p.S1923RfsX1950 FSP400 AR نعم فعلا الجزائر Exon32 c.6100C> T، p.R2034X FSP792 AR نعم فعلا المغرب Exon32 c.6100C> T، p.R2034X FSP845 معزول نعم فعلا المغرب Exon32 c.6100C> T، p.R2034X FSP881 AR نعم فعلا تونس Exon32 c.6100C> T، p.R2034X FSP920 AR نعم فعلا اليابان Exon36 c.6737_6740delTTGA، p.I2246SfsX2260 FSP75 AR لا البرتغال Exon37 c.6832_6833delAG، p.S2278LfsX2338 متماثل الطفرات موقع لصق FSP847 AR نعم فعلا الأرجنتين Intron4 c.869 + 1G> A، ص.؟ FSP892 معزول لا النرويج Intron12 c.2316 + 1G> A، ص.؟ FSP670 AR نعم فعلا العربية Isarelian- Exon15 c.2833A> G، p.R945GfsX950، r.2834_2835ins2834 + 1_2834 + 65 الطفرات متخالف مجمع FSP830 معزول لا البرتغال Exon6 c.1282A> T، p.K428X



Intron34 c.6477 + 4 A> G، ص.؟ (الربط) FSP343 AR لا الجزائر Exon7 c.1549_1550delCT، p.L517LfsX556



Exon36 c.6737_6740delTTGA، p.I2246SfsX2260 FSP522 معزول لا فرنسا Exon7 c.1471_1472delCT، p.L491DfsX556



Exon30 c.5532_5533delCA، p.S1844SfsX1857 SAL646 معزول لا فرنسا Exon8 c.1668delT، p.F556LfsX577



Exon36 c.6739_6742delGAGT، p.E2247LfsX2260 FSP683 معزول لا رومانيا Exon10 c.1951C> T، p.R651X



Exon31 c.5989_5992delCTGT، p.L1997MfsX2056 FSP398 AR لا بولندا لإسرائيل Exon25 c.4307_4308delAA، p.Q1436RfsX1442



Exon31 c.5986_5987insT، p.C1996LfsX1999
  • يشار إلى طفرات جديدة في جريئة.

وكانت معظم الطفرات طفرات هراء = 4، ثلاثة جديدة)؛ الحذف صغيرة = 13، 11 جديد) او الادخال (واحد جديد). وبالإضافة إلى ذلك، حددنا أربع طفرات جديدة يتوقع أن تؤثر على الربط للKIAA1840 مرنا والتي لم يتم العثور على 160 على الأقل و 62 قوقازي والكروموسومات السيطرة شمال أفريقيا، على التوالي. في FSP670 الأسرة الإسرائيلية-العربية، وc.2833A متماثل> طفرة G في كودون الحفظ الأخيرة من اكسون 15، مما أدى إلى p.R945G الاختلاف مغلطة، وقد تبين أيضا أن تؤثر على موقع إجماع 5 'لصق (درجة +2.7 مقابل +4.9 لتسلسل من النوع البري). وهذا ما أكده في التنبؤ SILICO على مرنا معزولة عن الابيضاض اللمفاوي من أحد أفراد الأسرة المتضررين (FSP670-5) الذي يتم إنشاء موقع بديل لصق المانحة المصب في إنترون 15 مما أدى إلى 65 نقطة أساس الإدراج وكودون وقف سابق لأوانه (الشكل 1؛ r.2834 + 1_2834 + 65ins، p.R945GfsX5). وكانت الطفرة c.2833A> G غائبة عن 103 صحي الفلسطينيين لا علاقة لها أيضا. في الأسر وكان توقع FSP892، G متماثل> A التحولات في المواقف c.869 + 1 + 1 وc.2316 في إنترون 4 و إنترون 12 FSP847 لتغيير بقوة النتيجة تسلسل إجماع من +9.8 إلى -0،9 ومن +6.2 ل -4،5، على التوالي. كان c.869 + 1G> تحور، وجدت في عائلة FSP847، غائبة من 48 صحي الأرجنتينيين لا علاقة لها أيضا. في مريض واحد من FSP830 الأسرة، الذي حمل طفرة هراء متخالف في اكسون 6 (c.1282A> T، p.K428X)، قام أيضا A> G الانتقال في موقف c.6477 + 4 في إنترون 34 الذي النتيجة لصق (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html) تم تخفيض 9،6-6،6. وكانت الخلايا الحية غير متوفرة، ولكن، لتأكيد في سيليكون تنبؤات missplicing في الأسر FSP847، FSP892 وFSP830.

تين. 1
طفرة c.2833A> G في FSP670 الأسرة يغير SPG11 مرنا الربط. (A) ويبين مخطط رحلاني الطفرة c.2833A> G. (B) النسب والفصل بين الطفرة في الأسرة. تمثل رموز مربع الرجال، والدوائر تمثل النساء. رموز شغل والأفراد المتضررين. الأرقام هي المرجعية الداخلية لكل فرد العينة. نجوم تشير موضوعات عينات. M = الطفرة. + = النوع البري. (C) الاغاروز هلام فصل المنتجات PCR ولدت من SPG11 كدنا] من موضوع المتضررين والضوابط يبين معالجة غير طبيعية من الرنا المرسال (D) التمثيل البياني للتأثير الطفرة. ومحاصر الإكسونات. يتم استخدام البديل لصق موقع المانحة في إنترون 15 في أليل متحولة مما أدى إلى 65 نقطة أساس الإدراج ووقف كودون سابقة لأوانها.

وتقع الطفرات التي تم تحديدها في 22 أو على مقربة من 15 الإكسونات المختلفة في جميع أنحاء الجينات، من اكسون 1 إلى اكسون 37. ومع ذلك، تم العثور على اثنين من هذه الطفرات في أكثر من عائلة واحدة. تم العثور على طفرة c.6100C> T / p.R2034X في أربع عشائر مختلفة من الجزائر والمغرب وتونس وأفيد سابقا في ثلاث عائلات شمال أفريقيا (Stevanin وآخرون، 2007). وكانت أجزاء من النسخ المتنوعة بناؤها مع أربع علامات المرافقة بشكل وثيق مماثلة في قبائل الأربعة الجديدة والأسر ذكرت سابقا، مما يدل على أن الحدث تغيري الأجداد المشترك (الجدول 2). الجديد طفرة c.6737_6740delTTGA / p.I2246_E2247> تم العثور S2246fsX في عائلتين من اليابان (متماثل) ومن الجزائر (متخالف) المرتبطة النسخ المتنوعة المختلفة كما هو متوقع. بالإضافة إلى ذلك، c.529_533delATATT / p.I177_I178del> S177fsX طفرة (Stevanin وآخرون، 2007)، وجدت سابقا في عائلتين البرتغالية، تم العثور في آخر المشابهة من نفس البلد (FSP831)، ويرتبط مع نفس النمط الفرداني (الجدول 2). في المقابل، فإن الطفرة c.733_734delAT / p.M245VfsX، وجدت سابقا على اثنين من الكروموزومات الأجداد مختلفة في الأسر الإيطالية والفرنسية (ديل بو وآخرون، 2007)، وكان متماثل في المرضى الذين يعانون من تونسي المشابهة المرتبطة النسخ المتنوعة المختلفة، مما يشير مستقلة أحداث طفرة وراثية أو طفرة قديمة جدا.

الجدول 2
النسخ المتنوعة من أربعة قريبة علامات المرافقة فصل مع الطفرات المتكررة في الجينات SPG11 في هذه الدراسة وفي تقارير سابقة (Stevanin وآخرون، 2007؛. ديل بو وآخرون، 2007)
http://brain.oxfordjournals.org/content/131/3/awm293i1
  • ND = لم تفعل. ويسلط الضوء على المناطق المحفوظة في الرمادي. يشار إلى المورثات في أزواج قاعدة.

المتغيرات أربعة النوكليوتيدات exonic موجودة في المرضى ولكن أيضا في> 2٪ من الكروموسومات التحكم من فرنسا وشمال أفريقيا من المحتمل أن تكون هذه الأشكال: c.808G> A / p.V270I (1.5 مقابل 2.3٪ في الضوابط)، c.1388T> C /p.F463S (47 مقابل 51٪)، c.3420G> A / p.L1140L (2.3 مقابل 3.3٪) وc.7023C> T / p.Y2341Y (1.5 مقابل 7.1٪). وقد تم بالفعل وصف p.F463S والمتغيرات p.L1140L في NCBI (http://www.ncbi.nlm.nih.gov) وEnsembl (http://www.ensembl.org) قواعد بيانات الجينوم البشرية، و حدثت تغيرات الصامتة في بقايا 1140 و2341 في ظل وجود طفرات اقتطاع متماثل في الجينات SPG11. وقد أظهرت أيا منها لتعديل مواقع لصق. تم الكشف عن ثلاثة الأشكال intronic إضافية على مواقع -139A> G و-141A> C اكسون المنبع 8، و+ 62C> T اكسون المصب 37 ولكن لم يتوقع أن يسبب missplicing من الجين SPG11.
الخصائص السريرية من 20 عائلة SPG11 جديدة (38 مريضا)

وكانت ست عائلات شمال أفريقيا (اثنان الجزائري، وهما تونسية واثنين المغربي)، وثمانية الأوروبي (أربعة من البرتغال، وهما من فرنسا، واحدة من رومانيا واحدة من النرويج)، وأربعة من منطقة الشرق الأوسط (اثنان الإسرائيلية، واحدة منها من أصل عربي ، واحد تركي واحد السعودي العربي) وواحدة في كل من الأرجنتين واليابان.
كان معظم الأسر (65٪) وراثي جسمي مقهور وضع اضح من الميراث، في حين أن سبعة مرضى مؤشر (35٪)، بما في ذلك خمسة دون القرابة، ليس لديهم تاريخ عائلي من الاضطرابات العصبية.
العمر عند بداية في 37 SPG11 المرضى تراوحت 2-27 بمتوسط ​​قدره 14.0 ± 5.9 سنوات. كانت البداية، في معظم الحالات، والتي تتميز اضطرابات المشية (30/38، 79٪)، أو أقل في كثير من الأحيان عن طريق التخلف العقلي (6/38، 16٪)، ونادرا ما التلفظ ورعاش (واحد لكل منهما). بعد مدة مرض متوسط ​​14.9 ± 6.6 سنوات (المدى: 2-35)، وكان جميع المرضى صورة سريرية شديدة شملت الشلل النصفي التشنجي التدريجي (الجدول 3): كان معظمهم على الأقل ملزمة على كرسي متحرك (20/38، 53٪) أو لا يزال يمكن المساعدة اللازمة للمشي (6/38، 16٪)، ولكن 12 المشي من دون مساعدة (الشكل 2). في حين اقتصرت فقط 12٪ من المرضى على كرسي متحرك أو طريح الفراش بعد <10 سنوات من المرض، كانت 60٪ في هذه الحالة بعد 18 عاما من التطور (الشكل 2). كان المرضى ملزمة على كرسي متحرك بعد مدة مرض متوسط ​​16.5 ± 5.8 سنة (المدى 9-35، ن = 20). كان الطرف السفلي التشنج الشديد في 25/37 (67٪)، ويرتبط مع ضعف شديد في 19/37 (51٪). ولوحظ الهزال البعيدة أو معمم أيضا في 20/38 (53٪). كثيرا ما لوحظ التلفظ = 16/38، 42٪). التخلف العقلي، ويتضح من صعوبات التعلم في مرحلة الطفولة، وكان حاضرا في 12 مريضا، وأكد في ثماني الذين لديهم معدل الذكاء متوسط ​​58 ± 9 (المدى: 45-69). بالإضافة إلى ذلك، في 80٪ (24/30) من المرضى، وكان التدهور المعرفي واضحا على فحص وتفاقمت مع مرور الوقت. وكانت عشرات MMSE منخفضة في 4/5 المرضى اختبار (<23/30). واحد فقط المريض، الذي كان أقصر مدة المرض (FSP683-3، 2 سنة)، لم يكن التخلف العقلي والتدهور المعرفي. خضع مريضين تقييم مفصل العصبية (FSP522-1 وFSP75-21). كان التقييم غير اللفظي الكفاءة المعرفية العالمية في المريض FSP522-1 العادي (PM38 = 46/60)، ولكن كان لديها ضعف الذاكرة الحاد (وكسلر ذاكرة القسمة = 72/140) يرتبط مع انخفاض الطلاقة اللفظية ونقص الانتباه الإرشادي من خلل التنفيذية. A التقييم الثاني، بعد 5 سنوات، وأظهرت تدهور الحالة المعرفية لها. FSP75-21 المريض، الذي كان التخلف العقلي (IQ = 56)، وأظهرت النتيجة MMSE من 21/30 في 35 عاما مع الصعوبات النفسية والمعرفية التي شملت هلوسات سمعية والاختلالات التنفيذية.


الجدول 3
المظاهر السريرية من 38 مريضا يعانون من الطفرات في الجين SPG11
المريض (الجنس) العمر عند بداية (سنة) أعراض في بداية العمر عند الامتحان (سنوات) مدة المرض (سنوات) شدة / التشنج في الساق ضعف / الهزال متلازمة الهرمية [UL / الركبة / ردود الفعل أخمصي] الضعف العقلي تدهور معرفي علامات أو أعراض أخرى FSP831-5 (M) 6 صعوبات تليها المشي التشنجي التعلم في سن 15 31 25 طريح الفراش / شديدة شديد / لا شيء ++ نعم فعلا نعم فعلا قدم جوفاء، وصعوبات في البلع






++









↑↑


SPD199-1 (F) 12 الهزة في الراحة والعمل 28 16 كرسي متحرك في سن 22 / حاد قسوة / معتدلة ++ نعم خفيفة ND الرعاش مع تعذر الحركة الشديدة، وصلابة ورعاش






+









↑↑


SPD199-15 (M) مرحلة الطفولة الساقين قاسية 21 NA المشي المساعدات في سن 20 / شديدة المعتدل / لا شيء ND نعم (MMSE 21/30) نعم فعلا الرعاش مع رعاش الراحة، strabism






++ (الكاحلين -على)









↑↑


FSP870-17 (M) 15 الساقين قاسية 25 10 المشية ممكن من دون مساعدة / شديدة قسوة / نعم N نعم (MMSE <15/30) نعم فعلا قدم جوفاء، خلل التوتر الوجه، وتحصي الكلوي






++









↑↑


FSP870-20 (F) 17 الساقين ضعف 28 11 كرسي متحرك في سن 28 / حاد شديد / لا شيء + نعم فعلا لا خلل التوتر الوجه واللسان






++









↑↑


FSP870-27 (F) 14 الساقين قاسية 29 15 كرسي متحرك في سن 27 / حاد شديد / لا شيء + نعم فعلا لا لا شيء






++









↑↑


FSP870-28 (F) 20 الساقين ضعف 42 22 كرسي متحرك في سن 38 / حاد المعتدل / لا شيء + نعم فعلا لا لا شيء






+









↑↑


FSP393-11 (F) 7 صعوبات التعلم 25 18 المشية ممكن من دون مساعدة / معتدلة خفيف / لا شيء ++ نعم فعلا نعم فعلا التلفظ التشنجي






++









↑↑


FSP393-12 (M) 7 صعوبات التعلم 24 17 المشية ممكن من دون مساعدة / معتدلة خفيف / لا شيء ++ نعم فعلا نعم فعلا التلفظ التشنجي، وانخفاض الشعور اهتزاز






++









↑↑


FSP838-1 (F) 13 الساقين قاسية 22 9 المشي المعونة / خفيفة المعتدل / لا شيء N صعوبات التعلم في سن 15 ND لا شيء






++









↑↑


FSP400-5 (F) 5 ضعف الساق 12 7 المشية ممكن من دون مساعدة / معتدلة متوسطة / المعمم ++ لا نعم فعلا التلفظ التشنجي






++









↑↑


FSP400-10 (M) 2 تأخر الاستحواذ على الأقدام والساقين قوية 13 11 المشية ممكن من دون مساعدة / معتدلة المعتدل / لا شيء ++ نعم (صعوبات التعلم) نعم فعلا التلفظ التشنجي، الجنف






++


↑ → FSP792-4 (M) 19 الساقين قاسية 32 13 المشية ممكن من دون مساعدة / شديدة الحادة / الساقين معتدلة الأسلحة الخفيفة N نعم (IQ = 45، MMSE = 23/30) نعم فعلا لا شيء






++









↑↑


FSP792-5 (F) 17 الساقين قاسية 37 20 المشي المعونة / شديدة شديد / القاصي خفيف N نعم (IQ = 47) نعم فعلا لا شيء






++









↑↑


FSP845-7 (M) 16 الساقين قاسية 29 13 كرسي متحرك / حاد قسوة / خفيفة N نعم (MMSE = 15/30) نعم فعلا لا شيء






++









↑↑


FSP881-143 (M) 16 الساقين ضعف 26 10 كرسي متحرك / حاد قسوة / خفيفة N لا ND لا شيء






++









↑↑


FSP881-144 (M) 14 الساقين ضعف 30 16 كرسي متحرك / حاد شديد / حاد N نعم خفيفة ND قدم جوفاء، الجنف






++









↑↑


FSP881-145 (F) 16 الساقين ضعف 26 10 المشي المعونة / شديدة شديد / لا شيء ++ لا ND لا شيء






++









↑↑


FSP920-1401 (M) 15 الساقين قاسية 26 11 كرسي متحرك / حاد متوسطة / المعمم خفيفة + نعم (IQ = 63) نعم فعلا بطء في الكلام، قدم جوفاء، والسمنة






+









↑↑


FSP920-1402 (M) 9 الساقين قاسية 18 9 كرسي متحرك في سن 25 / غ ND / لا شيء + نعم (IQ = 63) نعم فعلا قدم جوفاء






+









↑↑


FSP75-21 (F) 2 تلميح اصبع القدم المشي 24 22 المشية ممكن من دون مساعدة / شديدة متوسطة / شديدة ++ نعم (IQ = 52) نعم الهلوسة في سن 25 رأرأة، فرط، dysarthia، نقص ضغط الدم الانتصابي






++









↑↑


FSP75-43 (M) 7 صعوبات التعلم 33 26 كرسي متحرك / حاد قسوة / المعمم ++ نعم (IQ = 64) نعم فعلا التلفظ التشنجي






++ (- في الكاحلين)









↑↑


FSP847-22 (M) 15 عدم الثبات والساقين قوية 30 15 كرسي متحرك / حاد قسوة / المعمم ++ نعم فعلا ND التلفظ، والسعي رمشي، الرأسي والقيود نظرة أفقية، الجنف






++









↑↑


FSP847-23 (M) 16 عدم الثبات والساقين قوية 29 13 كرسي متحرك / حاد قسوة / المعمم ++ نعم فعلا ND التلفظ، والسعي رمشي، الرأسي والقيود نظرة أفقية، الجنف






++









↑↑


FSP847-25 (F) 15 عدم الثبات والساقين قوية 22 7 المشية ممكن من دون مساعدة / معتدلة المعتدل / خفيف LL القاصي ++ لا ND التلفظ، والسعي رمشي






++









↑↑


FSP892-3 (M) 22 التلفظ 30 8 المشية ممكن من دون مساعدة / خفيفة المعتدل / لا شيء N نعم فعلا نعم فعلا التلفظ التشنجي






++









↑↑


FSP670-4 (F) 12 صعوبات في الإدراك 31 19 كرسي متحرك / حاد شديد / لا شيء + نعم (IQ = 61) نعم فعلا الحنك يتقوس عالية، والجلد التصبغ






++









↑↑


FSP670-5 (F) 12 صعوبات في الإدراك 30 18 كرسي متحرك / الحاد شديد / لا شيء + نعم (IQ = 69) نعم فعلا


++

↑↑ FSP830-5 (F) 27 عدم الثبات 43 16 كرسي متحرك في سن 40 / حاد قسوة / معتدل والقاصي ++ لا نعم فعلا الضمور البقعي







↑↑


FSP343-1085 (M) 16 الساقين قاسية 33 17 المشي المعونة / شديدة المعتدل / خفيف UL + نعم (صعوبات التعلم) نعم فعلا رتة، قدم جوفاء، والحفر البقعي






++









↑↑


FSP343-1081 (F) 5 ضعف الساق 40 35 كرسي متحرك / المعتدل شديد / لا شيء N لا لا التهاب السحايا والدماغ بعد الحصبة وsequella (فالج اليسار والصرع)






++









↑↑


FSP343-1084 (M) 22 الساقين ضعف 37 15 المشي المعونة / معتدلة المعتدل / لا شيء + لا لا قدم جوفاء، التلفظ، رأرأة، والحفر البقعي






++









↑↑


FSP522-1 (F) 19 الساقين قاسية 25 6 المشية ممكن من دون مساعدة / معتدلة المعتدل / لا شيء + رقم (MMSE = 26/30) نعم (الذاكرة والوظائف التنفيذية) توزيع الدهون غير طبيعية، وانخفاض ضغط الدم الانتصابي






++









↑↑


SAL646-6 (F) 15 الساقين قاسية 23 8 المشية ممكن من دون مساعدة / معتدلة خفيف / لا شيء + نعم فعلا نعم فعلا قدم جوفاء، التلفظ التشنجي، اختلال الإحساس دبوس وخز، المتوفى في سن 36






++









↑↑


FSP683-3 (M) 18 الساقين قاسية 20 2 المشية ممكن من دون مساعدة / معتدلة معتدل معتدل UL / LL خفيف + لا لا الجنف






+









↑↑


FSP398-15 (F) 23 صعوبات المشية 42 19 كرسي متحرك / حاد متوسطة / شديدة + لا نعم فعلا التلفظ التشنجي، والسعي رمشي، وصعوبات في البلع






++ (- في الكاحلين)









NA


FSP398-17 (F) 17 الساقين قاسية 38 21 كرسي متحرك في سن 26 / حاد خفيفة / شديدة ++ لا نعم فعلا رتة، سلس البول، صعوبة في البلع






++









NA


FSP398-19 (F) 15 صعوبات المشية 35 20 طريح الفراش / شديدة شديد / حاد ++ لا نعم فعلا Strabism، التلفظ التشنجي، وصعوبات في البلع، والسعي رمشي






++ (- في الكاحلين)









NA


  • M = ذكور؛ F = أنثى؛ ND = لم تفعل. NA = غير المقررة؛ N = العادي؛ UL = الأطراف العلوية؛ LL = الأطراف السفلية. IQ = حاصل الفكري. MMSE = البسيطة التقييم دولة العقلية. + = المحسن؛ ++ = زيادة. اليسار ويشار إلى ردود الفعل أخمص القدم اليمنى على النحو التالي: '↑' = الباسطة، '→' = غير مبال.

ولوحظت علامات العين للدماغ مثل السعي رمشي غير طبيعي ورأرأة في سبعة مرضى، ومعظمهم كان لفترات المرض> 15 سنة (21/05 مقابل 17/02). كان هناك قدم جوفاء في ثمانية مرضى، الجنف في خمسة ووحظت علامات أخرى أحيانا: الشلل الرعاش، نقص ضغط الدم الانتصابي، والحفر البقعي أو انحطاط، الحول. وكان أربعة مرضى، مع كل فترات مرض> 18 عاما، صعوبة في البلع.
ومن المثير للاهتمام، الكشف عن ENMG أقل تورط الخلايا العصبية الحركية في 13/16 (81٪) بعد مدة مرض متوسط ​​14.4 ± 4.9 سنوات (جدول 4). في اثنين من المرضى، وكان هناك اضح تورط القرن الأمامي، في حين أن البعض الآخر كان هناك الاعتلال العصبي المحاور. أظهر المخ MRI لTCC (20/21، 95٪)، مع ضمور القشرية (17/21، 81٪) والمرتبطة منتشر الأبيض hyperintensities المسألة على الصور T2 (13/19، 69٪). تم العثور على ضمور الجسم الثفني في جميع ولكن مريض واحد (FSP400-5، 7 سنوات مدة المرض)، ولكن مع كثافة متغير (الشكل 3). كان Leucoencephalopathy تلين ومتموجة، وزادت حدته مع مدة المرض. في الحالات الخفيفة، واعتبر الضرر البطينات الدماغية الأمامية والقذالي فقط (الشكل 3). وأخيرا، فإن إمكانات أثار البصرية غير طبيعية في ثلاثة من أصل خمسة مرضى، مما يشير إلى توزيع أكثر انتشارا من الآفات.

تين. 3
صور الدماغ بالرنين المغناطيسي من ثلاثة المرضى الذين يعانون من مرض فترات مختلفة. (A) صورة السهمي تظهر رقيقة الجسم الثفني وضمور القشرية العالمي، (B)-T2 سريع تدور الصدى محوري المرجح والصور الاكليلية تبين hyperintensities البطينات الدماغية من شدة متغير وفقا لمدة المرض المرجحة T1.


الجدول 4
التحقيقات اسريرية في 27 SPG11 المرضى
شخص مدة المرض (سنوات) الشلل MRI ENMG إمكانات أثار

ضمور القشرية TCC WMA (N الاعتلال العصبي) (V البصرية، A السمعية والحسية الجسدية S) FSP522-1 6 - + - محور عصبي الحسية والحركية N A، V عادي FSP400-5 7 + - + (معتدل) طبيعي S غير طبيعي، V الطبيعي FSP847-25 7 + + NA ND ND SAL646-1 8 ND ND ND محور عصبي الحسية والحركية، ونمط العصبية V غير طبيعي، A، S العادي FSP892-3 8 - + - المحرك محور عصبي N ND FSP670-5 8 + (أمامي معتدل) + + ND ND FSP838-1 9 + + + (معتدل) طبيعي ND FSP920-1402 9 - + - ND ND FSP670-4 9 ND ND ND محور عصبي الحسية والحركية N V غير طبيعي FSP920-1401 11 - + - ND ND FSP870-20 11 ND ND ND محور عصبي موتور N ND FSP792-4 13 + + + المحرك محور عصبي N ND FSP845-7 13 + + + ND ND FSP847-23 13 + + NA ND ND SPD199-15 15 + + + محور عصبي الحسية والحركية N (خزعة: ضمور الأنسجة العصبية) ND FSP683-3 15 - + + (الخلفي) ND ND SPD199-1 16 + + + محور عصبي الحسية والحركية N ND FSP830-5 16 + + + المحرك محور عصبي N V غير طبيعي FSP393-12 17 ND ND ND الأمامي قرن ND FSP343-1085 17 + (معتدل) + - محور عصبي الحسية والحركية N ND FSP881-144 19 ND ND ND محور عصبي الحسية والحركية N S الطبيعي FSP792-5 20 + + + ND ND FSP75-21 20 + (خفيفة، الخلفية megaciterne) + - ND ND FSP398-17 21 + + + ND ND FSP831-5 15 + + + طبيعي V، A، S العادي FSP75-43 26 + + + (bifrontal) مشاركة القرن الأمامي ND FSP343-1081 35 + (sequellae الجبهي الجداري الآفة) NA NA ND ND
  • + = الحاضر. - = غائبة. ENMG = electroneuromyography. NA = غير المقررة؛ ND = لم تفعل. WMA = الاضطرابات التي تصيب المادة البيضاء. TCC = رقيقة الجسم الثفني.

نقاش

تحديد 22 الطفرات اقتطاع مختلفة (19 الجديد) توزع في جميع أنحاء الجينات SPG11 (الشكل 4) يؤكد على الحاجة إلى تحليل الجينات كله في الممارسة السريرية. فقط تم العثور على اثنين من هذه الطفرات في أكثر من عائلتين في هذه الدراسة والدراسات السابقة، مما يشير إلى مؤسسي إقليمي في هؤلاء السكان (Stevanin وآخرون، 2007): الطفرة c.6100C المتكررة> T / p.R2034X في الأسر من شمال أفريقيا حيث تمثل 70٪ من الحالات المبلغ عنها (7/10 الأسر تحور)؛ طفرة c.529_533delATATT / p.I177_F178> S177fsX في الأسر البرتغالية (3/6 الأسر تحور). ارتبطت النسخ المتنوعة يحفظ للالمرافقة الواسمات الوراثية مع هذه الطفرات.

تين. 4
التمثيل التخطيطي للجين SPG11 تبين موقع المعروفة (متابعة) والجديدة (أسفل) الطفرات. # ذكرت من قبل Stevanin وآخرون، 2007 وDelBo وآخرون، 2007.

أكثر من 20 عائلة SPG11 جديدة نشأت من حوض البحر الأبيض المتوسط، ولكن تم العثور على الطفرات أيضا في الأسر من الدول الاسكندنافية واليابان وأمريكا الجنوبية، مما يدل على التوزيع في جميع أنحاء العالم من هذا الكيان اكلينيكية الوراثية، كما اقترح سابقا (Shibasaki وآخرون، 2000؛ . كازالي وآخرون، 2004؛ الفائز آخرون، 2006؛. Stevanin وآخرون، 2006؛. Olmez وآخرون، 2006).
عندما الإحدى عشرة ذكرت سابقا الحالات (Stevanin وآخرون، 2007) من اتخاذ سلسلة لدينا في الاعتبار، تم العثور على SPG11 الطفرات في ~26٪ (9/35) من الواضح متفرقة HSP مع المرضى TCC و~40٪ (22/53 ) من الموضوعات مع معقد AR-HSP.ومن المثير للاهتمام، وتردد على نطاق واسع يختلف وفقا لالنمط الظاهري (جدول رقم 5). SPG11 تم العثور على طفرات في 59٪ من المرضى الذين يعانون من TCC والضعف العقلي التي جمعتها شبكتنا، تردد قريب جدا من 41-77٪ من الأسر من إيطاليا، اليابان وبلدان البحر الأبيض المتوسط ​​وجدت في التحليلات الربط السابقة (Shibasaki وآخرون. 2000؛ كازالي وآخرون، 2004؛ Stevanin وآخرون، 2006). الطفرات في SPG11 تمثل سوى عائلة واحدة (1/22، 4.5٪) من مجموعة فرعية من المرضى الذين يعانون من HSP وضعف الادراك دون TCC، ولكن كان المرضى من هذه المشابهة خفيفة تغييرات المادة البيضاء وضمور القشرية بعد مدة المرض قصيرة من 7 سنوات. لذا SPG11 هو السبب الرئيسي لتحديد HSP-TCC، وعند الأخذ بعين الاعتبار نسبة 1/3 من HSP-TCC بين ARHSP (فرانكا وآخرون، 2007)، SPG11 هو المسؤول عن ~21٪ من الأسر التي لديها ARHSP، مما يجعلها السبب الأكثر شيوعا لهذا المرض.

الجدول 5
تردد SPG11 الطفرات وفقا لالنمط الظاهري

الظواهر HSP المرتبطة مجموع

TCC والضعف الادراكي TCC دون الادراكي الادراكي (MRI لم تفعل) الادراكي دون TCC
هذه الدراسة عدد الحالات المؤشر 26 11 17 22 76
استبعاد عن طريق تحليل الربط / الأسر ملحوظة حللت 14/05 0/3 06/01 10/06 12/33
تحور حالات مؤشر / ملحوظة التسلسل الحالات 11/21 11/04 16/04 16/01 20/64
تردد SPG11 11/26 (42٪) 4/11 (36٪) 4/17 (23٪) 22/1 (4.5٪) 20/76 (20٪) هذه الدراسة وStevanin وآخرون. 2007 22/37 (59٪) 4/12 (33٪) 4/17 (23٪) 22/1 (4.5٪) 31/88 (35٪)
  • HSP = الشلل النصفي التشنجي راثي؛ TCC = رقيقة الجسم الثفني

المظاهر السريرية للSPG11 المرضى درس هنا كانت مشابهة لتقارير سابقة (Shibasaki وآخرون. 2000؛ كازالي وآخرون. 2004؛ الفائز وآخرون. 2006؛ Stevanin وآخرون. 2006؛ Lossos وآخرون، 2006) ، مع مجموعة واسعة من الأعمار في بداية (2-27 سنة). SPG11 شديد منذ المرضى كانوا ملزمة على كرسي متحرك بعد مدة مرض متوسط ​​16.5 ± 5.8 سنة (المدى 9-35، ن = 20) مقابل 26،6 ± 15 سنة (المدى 5-49، ن = 5) في المرضى الذين SPG4 (Depienne وآخرون آل.، 2006، 2007). التخلف العقلي أو ضعف الادراك وضمور في الجسم الثفني هي السمة المميزة لهذا الاضطراب، ولكنها قد تكون غير موجودة في المرضى الذين يعانون من مرض فترات قصيرة (<10 عاما). علامة متكررة آخر هو الاعتلال العصبي محور عصبي، ويرتبط أحيانا مع وجود علامات القرن الأمامي، لوحظ في 81٪ من المرضى المتضررين. هذا يدل على انخفاض تنكس الخلايا العصبية الحركية وربما التصلب الوحشي الضموري تقليد سريريا عندما يتم وضع علامة الهزال. وكثيرا ما لاحظت أيضا الاضطرابات التي تصيب المادة البيضاء على التصوير بالرنين المغناطيسي (69٪). يبدأون في المناطق المحيطة بالبطين قريبة من أمامي والقذالي قرون وزيادة في تواتر وشدة مع مدة المرض، مما قد يؤدي إلى خطأ في التشخيص من leucodystrophy. وأخيرا، قد تحدث علامات العين للدماغ أيضا كما تقدم المرض.
النمط الظاهري من 21 مريضا من 15 قبيلة مع TCC والضعف العقلي ولكن لا طفرات في SPG11 لم تختلف عن SPG11 المرضى باستثناء عصر المتوسط ​​في وقت سابق في بداية 9.6 ± 13.0 (المدى: 6 أشهر إلى 50 سنة). وكان عدم الاستقرار مشية علامة على بداية في جميع المرضى وكانت علامات المخيخ الحالية في 5. ثمانية من هؤلاء الأفراد 15 كانت متفرقة.
وباختصار، فإن وجود HSP-TCC هو أفضل مؤشر واحد أن SPG11 ينبغي اختبار في المرضى الذين يعانون من بداية في أول العقد الثالث، ولكن وجود واحد أو أكثر من العلامات الأخرى، مثل التخلف العقلي وتدهور المعرفي لاحق أقل، محرك تورط الخلايا العصبية وآفات المادة البيضاء، ويزيد من فرصة التعرف SPG11 الطفرات. بالإضافة إلى ذلك، دليل على الاضطرابات التي تصيب المادة البيضاء في المناطق المحيطة بالبطين يزيد أبعد من ذلك احتمال أن SPG11 هو سبب المرض، وليس لأسباب أخرى من leucodystrophy. HSP يؤثر أساسا على محاور القشري من خلال آلية الموت مرة أخرى ولكن الآفات في SPG11 وأوسع، كما اقترح تحديد TCC وغيرها من الاضطرابات التي تصيب المادة البيضاء، وعلامات انخفاض العصبون الحركي انحطاط، رنح مخيخي وغير طبيعية إمكانات أثار البصرية. هناك حاجة إلى مزيد من الدراسات الآن لفهم آثار هذه الطفرات، كل مقطوعة، مما تسبب في فقدان وظيفة spatacsin في الخلايا العصبية الحركية العليا والسفلى وكذلك في مناطق أخرى من الجهاز العصبي.

المواد التكميلية

هي المواد التكميلية المتاحة في الدماغ عبر الإنترنت.

شكر وتقدير

المؤلفون ممتنون لاسر الضحايا والأطباء الذين يشار المرضى لنا، لالدكاترة سمير بلال، صباح الدين Cirak، ميشال كونيغ، كلوتيلد Lagier-Tourenne وميرل Ruberg لمساهمتهم في هذه الدراسة، إلى الدكاترة نزار Elleuch، محمد عماد ميلادي كاثرين Lubetzki، بيلار Mazetti وفريدريك Sedel للتحقيقات سريرية إضافية ونوال Benammar، إيلودي دينيس، استل Ferdiko وDNA وبنك الخلايا من IFR70 للحصول على المساعدة الفنية. وقد تم تمويل هذه الدراسة من قبل الوكالة الوطنية صب لا للبحوث (فرنسا، إلى AD وGS)، وعقدي الأساس (ألمانيا، لA.Br)، وصندوق فرنسا هداسا للدراسة في الشلل النصفي التشنجي (فرنسا، إلى AL) وGROUPEMENT من أجل المصلحة العلمي - بمعهد علل راريس (فرنسا، A04180DS / A04139DS إلى GS). وتم دعم PD وFMS من المنح المقدمة من FONDAZIONE مارياني ONLUS وتيليثون إيطاليا (GGP06188).

ملحق

أعضاء مشلول الشلل النصفي وشبكة ترنح (SPATAX): الدكتور A. الدر (المسمى Hôpital بيتي-Salpêtrière، باريس، فرنسا)، العلاقات العامة B. فونتين (المسمى Hôpital بيتي-Salpêtrière، باريس، فرنسا)، العلاقات العامة JP ازولاي (المسمى Hôpital دي لا Timone ، مرسيليا، فرنسا)، العلاقات العامة A. بنعمر (CHU، الرباط، المغرب)، العلاقات العامة E. برتيني (OSP. بامبينو جيسو، روما، إيطاليا)، والدكتور O. Boespflug-تانجي (كلية الحقوق دي الطب، كليرمون فيران، فرنسا) ، العلاقات العامة P. كوتينهو (مستشفى سان سيباستيان، سانتا ماريا دا فييرا، البرتغال)، العلاقات العامة A. Filla (جامعة ديلي ستودي دي نابولي فيدريكو الثاني، نابولي، إيطاليا)، البروفسور د. Hannequin (المسمى Hôpital شارل نيكول، روان، فرنسا)، الدكتور A. حمري (المسمى Hôpital Benbadis، قسنطينة، الجزائر)، البروفسور ميشيل كونيغ (IGBMC، إلكيرش، فرنسا)، العلاقات العامة P. Labauge (المسمى Hôpital Caremeau، نيم، فرنسا)، العلاقات العامة A. Lossos (مستشفى هداسا الجامعة العبرية في القدس، إسرائيل )، العلاقات العامة A. Megarbane (جامعة القديس يوسف، بيروت، لبنان)، العلاقات العامة JE نيلسن (معهد Panum، كوبنهاغن، الدنمارك)، البروفسور AM Ouvrard هرنانديز (CHU، غرونوبل، فرنسا)، والدكتور E. ريد (مستشفى أدينبروكس، كامبريدج، المملكة المتحدة)، والدكتور D. رودريغيز (مستشفى Hôpital سانت فنسنت دي بول، باريس، فرنسا) البروفسور S. الروماني (DPT لعلم الأعصاب، دمشق، سوريا)، البروفسور محمد صالح (مستشفى جامعة، الرياض، المملكة العربية السعودية)، العلاقات العامة J . Sequeiros (جامعة بورتو، بورتو، البرتغال)، والدكتور C. Tallaksen (مستشفى جامعة Ullevål، أوسلو، النرويج)، العلاقات العامة M. تعزير (CHU مصطفى، الجزائر، الجزائر)، العلاقات العامة F. تايسون (جروب HOSPITALIER سود، بيساك، فرنسا)، الدكتور C. Goizet (المسمى Hôpital Pellegrin، بوردو، فرنسا)، والدكتور EM فالنتي (معهد دي GENETICA الطبية، روما، إيطاليا)، العلاقات العامة N. الخشب (المستشفى الوطني، لندن، المملكة المتحدة)، والدكتور C. Verny (CHU ، انجيه، فرنسا) والعلاقات العامة T. وارنر (رويال فري وكلية كلية الطب جامعة لندن، المملكة المتحدة).

رافت ابراهيم 11-22-2015 08:30 PM

يتفاعل وراثي تشنجي البروتين الشلل النصفي spastin مع ESCRT-III-يرتبط بروتين معقد endosomal CHMP1B
 
http://hmg.oxfordjournals.org/content/14/1/19.full

ملخص

يتميز النقي الشلل النصفي التشنجي وراثي عن طريق تعتمد على طول انحطاط الغايات البعيدة من المحاور طويلة. الطفرات في spastin هي السبب الأكثر شيوعا لهذه الحالة. شرعنا في تحقيق وظيفة spastin باستخدام نهج يومين الهجين الخميرة لتحديد البروتينات التفاعل. باستخدام كامل طول spastin كطعم، حددنا CHMP1B، وهو بروتين يرتبط مع ESCRT (endosomal الفرز المعقدة اللازمة لنقل) -III مجمع، كشريك ملزمة. وأكدت عدة طرق مختلفة أهمية الفسيولوجية للتفاعل في خلايا الثدييات. CHMP1B وأظهرت spastin اضح حشوية شارك في التعريب في كوس-7 وPC12 الخلايا الموسومة حاتمة. CHMP1B وspastin تفاعلت بشكل خاص في المختبر والمجراة في β-اكتاماز فحوصات البروتين جزء تكامل، وimmunoprecipitated المشارك spastin مع CHMP1B. تم بوساطة التفاعل من قبل منطقة spastin الواقعة بين بقايا 80 و 196 و تحتوي على أنيبيب التفاعل ومجال الاتجار. التعبير عن CHMP1B الموسومة حاتمة في خلايا الثدييات منع تطور النمط الظاهري أنيبيب غير طبيعي يرتبط التعبير عن أتباز معيب spastin. وتشير هذه البيانات إلى دور للspastin في أحداث المرور غشاء الخلايا وتوفير مزيد من الأدلة لدعم الاعتراف الناشئة التي عيوب في حركة غشاء الخلايا هي سبب كبير من الخلايا العصبية الحركية علم الأمراض.

مقدمة

ويمكن تقسيم الرئيسي مسار السيارات الطوعي إلى مرحلتين. أولا، الخلايا العصبية الحركية العليا (UMNs) في القشرة الحركية في الدماغ الاتصال عبر مساحات القشري للخلايا في المادة الرمادية للنخاع الشوكي. ثانيا، وانخفاض الخلايا العصبية الحركية (LMNs) في القرن الأمامي للنخاع الشوكي تتصل عضلات الهيكل العظمي في الوصل العصبي العضلي (1). المحاور من UMNs وLMNs طويلة للغاية، مع وحدات التخزين حشوية أكبر بكثير من خلايا الجسم. وبالتالي فإنها توفر بيئة متطرفة للعديد من العمليات الخلوية، مثل الاتجار داخل الخلايا والنقل والتمثيل الغذائي للطاقة.
بالإضافة إلى أن يكون متصلا تشريحيا، ترتبط UMNs وLMNs التي كتبها علم الأمراض. المرض الأكثر شهرة على نطاق واسع من الخلايا العصبية الحركية هو مرض التصلب الضموري الجانبي (مرض العصبون الحركي)، وهي حالة عادة متقطعة التي تتأثر بها كل من UMNs وLMNs. وبالإضافة إلى ذلك، ترتبط عدة مجموعات من الشروط المحددة وراثيا مع ضعف الخلايا العصبية الحركية. وإن كان نادرا بشكل فردي، هذه الشروط توفر فرصة لتشريح العمليات الخلوية العاملة في صيانة وانحطاط الخلايا العصبية الحركية. وparaplegias تشنجي وراثي (شركائنا HSPs) هي واحدة من هذه المجموعة وتحديد الخصائص التي السريرية هي الشلل التشنجي التدريجي التي تؤثر على الساقين، وعادة ما يحدث ذلك من قبل تعتمد على طول، انحطاط الأعلى من المحاور السبيل القشري (2 - 4).
سريريا، يتم تقسيم شركائنا HSPs إلى أشكال نقية ومعقدة، مع شركائنا HSPs نقية، حيث يحدث التشنج في عزلة نسبية، وتشكيل واحدة أكبر مجموعة فرعية. تم تعيين أكثر من 20 مواضع HSP وتم تحديد 10 من الجينات المرتبطة (إعادة النظر في 2). الجين SPG4، spastin، هو HSP الجينات الأكثر شيوعا، مع الطفرات وجدت في ~40٪ من الأسر نقية المهيمنة مقهورة HSP (5، 6). يتم التعبير عن spastin نسخة كاملة الطول على نطاق واسع داخل الجهاز العصبي والأنسجة في غير العصبية، بما في ذلك مجموعة من الخلايا المتصلة الكريات البيض. يتم التعبير عن ذلك بشدة في الفئات الفرعية من الخلايا العصبية (5، 8). محاضر Spastin تفتقر إما الإكسونات تم العثور على 4 أو 8 أو 15، على الرغم من أن يتم التعبير عن المتغير فقط اكسون 4 حذف في مستويات كبيرة (7، 9).
وكانت البيانات على توطين التحت خلوية من spastin الذاتية المتعارضة. على الرغم من أن الدراسات المناعي في وقت مبكر باستخدام الأجسام المضادة لمكافحة spastin على الأنسجة الماوس والبيني خلايا هيلا اقترح أن spastin الذاتية المترجمة حصريا في النواة (7)، وقد وجدت الدراسات اللاحقة باستخدام الأجسام المضادة أخرى النووية المختلطة والتوزيعات حشوية في خلايا هيلا (10، 11) وخطوط الخلايا العصبية الحركية الخلية (11) وأنسجة الجهاز العصبي الإنسان (8). في الأنسجة العصبية البشرية، يقع spastin في السيتوبلازم ومتشابك محطات عدة أنواع الخلايا العصبية، بما في ذلك الخلايا العصبية الحركية، على الرغم من أنواع الخلايا العصبية الأخرى التي كانت موجودة في النواة (8).
وتعريب التحت خلوية مختلفة تم تحديدها لspastin تدل على أن البروتين قد يكون له عدة أدوار وظيفية مختلفة، ومجموعة كاملة من التي ليست واضحة حتى الآن. تحليل تسلسل المبكر وضع spastin في AAA (ATPases المرتبطة بالأنشطة الخلوية المتنوعة) أسرة، أسرة متعددة مجموعة كبيرة من البروتينات التي تحتوي على أتباز كاسيت مميزة والمشاركة في العديد من العمليات الخلوية المختلفة (5، 12). Spastin هو عضو في مجموعة فرعية AAA-7 الذي يحتوي على katanin P60، وهو بروتين قطع أنيبيب، وخلية ثقافة والحية وتشير البيانات إلى أن وظيفة واحدة على الأقل من spastin تتضمن تنظيم الأنابيب الدقيقة. في المراحل المبكرة من التعبير في كوس-7 مثقف الخلايا، spastin الموسومة حاتمة المحلية في السيتوبلازم، على مقربة من مركز زهور النجمة أنيبيب. مع التعبير في وقت لاحق، فإنه المترجمة إلى منقط منفصلة الهياكل حشوية لا تقابل العضيات المعروفة (13). وارتبط التعبير البرية من نوع spastin مع حزم أنيبيب مكسورة وعندما أعرب عن أتباز معيب الموسومة حاتمة spastin، اشتركت المترجمة مع حزم محيط بالنواة سميكة بشكل غير طبيعي وطويلة من الأنابيب الدقيقة (13). وقدمت نتائج مماثلة في العصبونات القشرية الفئران مثقف (14). وقد تم مؤخرا تمديد هذه النتائج من خلال دراسة immunolocalization الذي حدد مستويات عالية من spastin الذاتية في المناطق التحت خلوية حيث يتم تنظيم الأنابيب الدقيقة حيوي. في تقسيم بنشاط خلايا كوس-7 وهيلا، تم العثور spastin على الأنابيب الدقيقة الجسيم المركزي والمغزل خلال الطورية، وعلى المغزل المركزي وأوسط الجذع أثناء الانقسام السيتوبلازمي. في خط الخلية العصبية الحركية، وأعرب عن غاية spastin في نهايات القاصي ملحقات محوار وعند نقاط الفرع. حددت هذه الدراسة أيضا NA14 البروتين centrosomal كشريك ملزم للspastin (11).
بيانات من نماذج ذبابة الفاكهة أيضا دعم دور للspastin في تنظيم أنيبيب (15). ذبابة الفاكهة spastin غير المخصب (D-spastin) ولا سيما في حبات متشابك، وشارك أنك تؤسس-مع متشابك synaptotagmin الحويصلة علامة في المناطق العصبية حيث ميكروتثبول مستقرة عادة ما تكون غائبة. استهداف RNA تدخل ضربة قاضية لل-D spastin في الجهاز العصبي تسبب شجيرات متشابك والحد من مجموع مساحة متشابك، مع تعزيز المقابلة من قبل المشبكي قوة العصبي الذي تم تصحيحه دواء من قبل نوكودازول، وكيل زعزعة استقرار أنيبيب. كانت الحيوانات زيادة في تويولين مستقر من الناحية الهيكلية في الوصل العصبي العضلي محطة قبل المشبكي، مع زحف الأنابيب الدقيقة في حبات قبل المشبكي. على العكس من ذلك، أدى overexpression من D-spastin إلى انخفاض في كمية تويولين مستقر من الناحية الهيكلية في الوصل العصبي العضلي محطة قبل المشبكي وانخفاض في قوة العصبي الذي تم تصحيحه من قبل أنيبيب استقرار وكيل التاكسول. هذه البيانات متسقة مع فرضية أن D-spastin يمكن أن ينظم مباشرة أو غير مباشرة الاستقرار أنيبيب ويمكن أن تقيد مكانيا الأنابيب الدقيقة استقرت في حبات قبل المشبكي (15).
على الرغم من كل البيانات لافتا نحو وظيفة أنيبيب تنظيم لspastin، كون انها وجدت في منقط أو أنبوبي الهياكل حشوية عندما أعرب في خلايا الثدييات، وأنه يختلف مكانيا من الأنابيب الدقيقة مستقرة في المحاور ذبابة الفاكهة يشير إلى أنه قد يكون أدوار أخرى . ومن بين الاقتراحات التي spastin قد يكون متورطا في أحداث المرور غشاء الخلايا. Spastin ديه N-محطة المتفاعل أنيبيب والاتجار (MIT) المجال. ويشترك في هذا المجال مع العديد من البروتينات التي حددت الأدوار في حركة الغشاء، بما في ذلك VPS4، وهو AAA (ATPases المرتبطة بالأنشطة الخلوية المتنوعة) بروتين من نفس فرعية كما spastin والفرز نيكسين 15 و calpain-7 / PalB (16، 17) . ومن المثير للاهتمام، وجدت المجال MIT أيضا في spartin، وهو بروتين تحور في متلازمة تروير، جسمية متنحية HSP تعقيدا بسبب التلفظ، ضمور عضلي القاصي وتأخر في النمو المعتدل (16).
وتنقسم الخلايا مسارات حركة الغشاء إلى مكونات الإفرازية والتقامي (18). في مسار التقامي، يتم تسليم مستقبلات المنضوية والبروتينات عبر الغشاء من غشاء البلازما لالإندوسومات في وقت مبكر، من حيث أنها قد تكون إعادة تدويرها إلى غشاء البلازما، تستهدف جولجي، وسلمت إلى الإندوسومات المتأخرة والجسيمات الحالة لتدهور أو، في خلايا الاستقطاب، transcytosed (18). كما الإندوسومات تربط إفرازية، واستيعاب والعمليات الهادمة، أنها تعمل كمواقع الفرز الهامة. وقد تم تحديد المكونات الجزيئية الرئيسية للمسار التقامي من خلال تحليل الخميرة المسوخ VPS، مقسمة إلى فئات A-F اعتمادا على الموقع من تأثير (19). المسوخ VPS فئة E هي ذات أهمية خاصة لهذه الدراسة. ومن المعروف المسوخ لا يقل عن 17 فئة الخميرة E VPS ولكل منها نديد بشري واحد على الأقل. وهي ضرورية لتشكيل الجسم عديد الحويصلات، هيكل endosomal أواخر شكلتها انغلاف والناشئين من الغشاء المحدد في تجويف الحويصلة (19). جسم عديد الحويصلات الصمامات مع يحلول، مع ما يترتب على التعرض للأغشية المنضوية إلى المقصورة الهادمة lumenal (19). وقد حددت الدراسات الأخيرة ثلاثة مجمعات البروتين غشاء المرتبطة ذات الصلة، ووصف ESCRT (endosomal الفرز المجمعات المطلوبة للنقل) من أنا، و-III-II، والتي تتكون من بروتينات الطبقة E VPS (20 - +22). هذه المجمعات يجوز توظيف بالتسلسل من السلائف حشوية والتوسط فرز الشحنات إلى الجسم عديد الحويصلات. ويعتقد مجمع ESCRT-III ليكون مسؤولا عن الفرز النهائي والتركيز البضائع إلى مجموعة فرعية من أغشية الجسم عديد الحويصلات (22). يتكون هذا المجمع من أربعة على الأقل من الدرجة E VPS البروتينات التي تعتبر جميع أفراد الأسرة البروتين نفسه، Chm2p، Chm3p، Chm4p وChm6p (وتسمى أيضا Vps2p، Vps24p، Vps32p / Snf7 وVps20p على التوالي في الخميرة، الموافق CHMP2A و2B، CHMP3، CHMP4A، 4B و 4C وCHMP6 في البشر) (+22 - +24). وقد تم تحديد اثنين آخرين من أعضاء الأسرة آلية تبادل المعلومات، Chm1p / Did2p (الموافق CHMP1A وCHMP1B في البشر) وChm5p / Vps60p (الموافق CHMP5 في البشر) (+22 - 24)، على الرغم من أنه ليس من الواضح ما إذا كانت تشكل جزءا من مجمع ESCRT-III أم أنها تنظيم وظيفة ESCRT-III (22). يتم تنظيم جمعية غشاء من البروتينات آلية تبادل المعلومات من قبل الطبقة E المبادئ الطوعية البروتين Vps4p (التي نوقشت في وقت سابق)، والذي قد يحفز تفكيك مجمع ESCRT-III (19، +22 - +25). VPS4 موجود في شكلين في البشر، VPS4A وVPS4B (23، 24، 26). بالإضافة إلى دورها في حركة الغشاء، المترجمة إلى الإسوي من CHMP1A الإنسان إلى النواة (27).
في هذه الدراسة، شرعنا في اكتساب رؤى جديدة في وظيفة spastin، باستخدام نهج يومين الهجين الخميرة لتحديد الشركاء ملزم للبروتين. باستخدام كامل طول spastin كطعم حددنا اثنين من البروتينات المشاركة في حركة الغشاء، CHMP1B وgp25L2، كشركاء محددة ملزمة. نظرا للتشابه بين spastin وVPS4 ومع الأخذ في الاعتبار القوة النسبية للتفاعلات الخميرة اثنين الهجين التي تم الحصول عليها مع اثنين من الشركاء ملزم المفترضة، اخترنا لتحديد أولويات التفاعل مع CHMP1B للدراسة. لقد أكدنا على أهمية الفسيولوجية للتفاعل في خلايا الثدييات من الدراسات التحت خلوية شارك في التعريب، وتقسيم β-اكتاماز البروتين جزء المقايسات تكامل والدراسات المشارك مناعي. ونظرا للدور CHMP1B في الاتجار غشاء endosomal، وتشير هذه البيانات إلى أن spastin، مثل الجينات HSP أخرى، قد تلعب دورا في أحداث المرور الغشاء.

النتائج

خميرة التجارب يومين الهجينة تحديد CHMP1B وgp25L2 كشركاء ملزم المحتمل لspastin

استخدمنا كامل طول spastin البروتين ك "الطعم" لفحص الخميرة الإنسان يومين الهجين مكتبة erythroleukaemia كدنا] عالية التعقيد، كما هو موضح سابقا (28). هذه الشاشة ولدت 16 استنساخ مضاعفا الإيجابية التي نمت على انتقائية وسائل الإعلام التي تفتقر إلى الأدينين وكانت ايجابية للنشاط β غالاكتوزيداز. عندما تم اختبار هذه التفاعلات الأساسية في الخميرة الطازجة تم العثور على اثنين فقط على حد سواء استنساخه والطعم محددة. الى رموز اثنين إيجابية "فريسة" استنساخ البروتين gp25L2 (NM_017510)، التي أظهرت ضعف ملحوظ بعد النشاط β غالاكتوزيداز والنمو يقتصر على وسائل الإعلام انتقائية تفتقر التربتوفان، ليسين والأدينين (-W / L / A)، وCHMP1B (NM_020412 ، المعروف أيضا باسم CHMP1.5)، التي عرضت قوي النشاط β غالاكتوزيداز والنمو القوي على انتقائية (-W / L / A) وسائل الاعلام (الشكل 1 A و B). كما ظهرت spastin للتفاعل بقوة أكبر مع استنساخ CHMP1B فريسة، اخترنا لتحليل خصوصية وأهمية الفسيولوجية لهذا التفاعل في خلايا الثدييات.
http://hmg.oxfordjournals.org/conten...9/F1.small.gif
يتفاعل الشكل 1. Spastin مع gp25L وCHMP1B في الخميرة نظام هجين اثنين. (A) الإيجابية مستعمرات الخميرة مضاعفا معزولة من الخميرة شاشة يومين الهجين التي بالطول spastin كان يستخدم تم نقل البروتين الطعم لالفلاتر واختبار لتفعيل β غالاكتوزيداز مراسل الجينات. الخلايا مضاعفا تحتوي على spastin واحد من اثنين من البروتينات المختلفة فريسة غير محددة (NSP1 وNSP2) لا تظهر أي تلون أزرق بعد فحص β غالاكتوزيداز، في حين أن الخلايا مضاعفا تحتوي على spastin وgp25L2 أو spastin وCHMP1B تظهر ضعيفة أو قوية النشاط β غالاكتوزيداز، على التوالي. (B) إعادة تأكيد التفاعل الملحوظ بين spastin وgp25L2 أو CHMP1B في الخميرة الطازجة. العمود 1 يبين نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر اليوراسيل ويسين (-U / L) لتحديد وجود كل من الطعم وفريسة ناقلات، في حين يبين العمود 2 نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر اليوراسيل، ليسين والحامض الاميني، الأمر الذي يتطلب تفعيل صاحب مراسل الجينات. في كل spastin حال تم استخدامها باسم "الطعم"، في حين استخدمت gp25L2 أو CHMP1B كما بروتينات "فريسة".

توزيع الخلايا من spastin الموسومة حاتمة وCHMP1B

البيانات الموجودة على توطين التحت خلوية من spastin متضاربة ولم يتم الإبلاغ عن توطين التحت خلوية من CHMP1B سابقا، لذلك علينا أولا إجراء الدراسات المناعي لدراسة التوزيع التحت خلوية من الموسومة حاتمة spastin البشرية والبروتينات CHMP1B. لتجنب سوء الفهم وتقييم المحتملة للتغيرات الناجمة عن العلامة في توزيع البروتين، وقارنا توطين التحت خلوية النسبي من ثلاث نسخ الموسومة المختلفة لكل من البروتين. تم الموسومة البروتينات في إما N أو C-محطة مع GFP (GFP-Spastin، Spastin-GFP، GFP-CHMP1B وCHMP1B-GFP) أو في N-محطة مع ج myc حاتمة (MYC-Spastin وmyc- CHMP1B). للمساعدة في تقييم ما إذا كان السبب في اختلاف في توطين التحت خلوية من spastin في خلية ثقافة تجارب ترنسفكأيشن مقابل الدراسات باستخدام أجسام مضادة ضد بروتين الأصلي عن طريق توطين التفاضلية من اكسون 4 حذف وكامل طول إيسفورمس من spastin، قدمنا ​​C-محطة بناء الموسومة GFP تحتوي على النموذج اكسون 4 حذفها من spastin (SpastinΔex4-GFP، الشكل 2). وأعرب عن بنيات عابر في كوس-7 وPC12 الخلايا، وجرى تقييم توزيع فرعية الخلوية النسبي لكل بروتين بواسطة المجهر مضان.
http://hmg.oxfordjournals.org/conten...9/F2.small.gif
الشكل 2. رسم تخطيطي من كامل طول spastin وأربعة أشكال أخرى من تحور spastin المستخدمة في هذه الدراسة. معهد ماساتشوستس للتكنولوجيا، والتفاعل أنيبيب ومجال الاتجار؛ AAA، أتباز المرتبطة متنوعة الأنشطة الخلوية المجال.

Spastin.

أعطى التعبير عن GFP-Spastin، Spastin-GFP أو MYC-Spastin نتائج مماثلة. وأعرب عن الثلاثة داخل سيتوبلازم خلايا كوس-7 (لا تظهر البيانات) وغير متمايز (الشكل 3 أ) أو الخلايا PC12 متباينة (الشكل 3 B و C)، بما يتفق مع الملاحظات السابقة (13، 14). تم المترجمة Spastin في الغالب إلى هياكل إما منقط أو أنبوبي التي لوحظت في البداية في منطقة محيط بالنواة. في نقطة زمنية لاحقة (48 ساعة أو أكثر)، لوحظت منقط والهياكل الأنبوبية أكثر اتساعا أيضا في المناطق الأكثر هامشية للخلية. في الخلايا PC12 متمايزة لديها ملحقات محوار، كان ينظر التعبير spastin منقط في سوما وأيضا داخل neurites التي. ضمن neurites التي كانت في كثير من الأحيان التعبير الأبرز في نهايات البعيدة (الشكل 3 B و C). التعبير عن SpastinΔex4-GFP بناء في كوس-7 أعطت خلايا نتائج متطابقة إلى التعبير عن كامل طول spastin، مع عدم وجود توطين النووية (لا تظهر البيانات).
http://hmg.oxfordjournals.org/conten...9/F3.small.gif
الشكل 3. توزيع التحت خلوية من spastin وCHMP1B البروتينات الموسومة حاتمة في كوس-7 وPC12 الخلايا. (A-C و G-I) خلايا PC12، (D-F) كوس-7 الخلايا. (A-C) تبين توزيع spastin تنصهر إلى GFP في دورته N-محطة (A)، C-محطة (B)، أو لحاتمة ج myc في دورته N-محطة (C). (D-I) تبين توزيع CHMP1B تنصهر إلى GFP في دورته N-محطة (D و G) أو C-محطة (E و H)، أو لحاتمة ج myc في دورته N-محطة (F و I) . في كوس-7 الخلايا، وكانت الهياكل النووية منقط أكثر بروزا وتلطيخ محيط بالنواة أقل وضوحا مع البروتين GFP-CHMP1B الانصهار (D) بالمقارنة مع غيرها من اثنين من البروتينات CHMP1B الانصهار. وشوهدت المصفوفات الخطية من حين لآخر نقاط والمسمى (أقحم في F). تم إصلاح الخلايا كوس-7 وتجهيزها للفحص المجهري 24 ساعة بعد ترنسفكأيشن وPC12 الخلايا 48 ساعة بعد ترنسفكأيشن.

CHMP1B.

وكان توزيع التحت خلوية من MYC-CHMP1B والبروتينات الانصهار CHMP1B-GFP في عابر. كوس-7 مماثل على نطاق واسع. وقد لوحظت في كل من النواة والسيتوبلازم (الشكل 3 E و F). داخل النواة CHMP1B عرضت في الغالب توزيع منتشر / الحبيبية، على الرغم من أن الخلايا عرضية أظهرت منقط إضافي وضع العلامات النووي. داخل السيتوبلازم البروتينات الانصهار كانت محلية في الغالب إلى العديد جدا، والهياكل منقط الصغيرة التي كانت موجودة في جميع أنحاء السيتوبلازم. بالإضافة إلى ذلك، كتل من هياكل دائرية أكبر، تذكرنا جدا من حويصلات بغشاء، كانوا حاضرين، ومعظمها في قبعة محيط بالنواة البؤري. في نسبة الخلايا المصابة بالعدوى بالنقل مع CHMP1B-GFP، ولكن ليس MYC-CHMP1B، غطاء محيط بالنواة حويصلات يرد، والهياكل حويصلي المسمى تضخم غير طبيعي. عموما، هذا التوزيع الخلوي مماثلة لتلك التي سبق وصفها للبروتين CHMP1A ترتبط ارتباطا وثيقا (24). على الرغم من أن العديد من الهياكل منقط وصفت أيضا في جميع أنحاء السيتوبلازم في بعض الخلايا معربا عن GFP-CHMP1B، كانت هناك اختلافات مقابل البروتينات الانصهار الأخرى. وكان العديد من الخلايا تنتشر العلامات حشوية، وحيث لم يكن منتشر وضع العلامات، ونادرا ما يلاحظ الغطاء محيط بالنواة هياكل حويصلي ينظر مع البروتينات الانصهار الأخرى. بدلا من ذلك، تميل منقط وصفت والهياكل الأنبوبية أن يكون حاضرا في السيتوبلازم في جميع أنحاء النواة، ولا سيما في الخلايا معربا عن أعلى. بالإضافة إلى ذلك، كان تلطيخ النووي منقط أكثر شيوعا بكثير من مع بنيات أخرى (الشكل 3 D).
في الخلايا PC12، وكان كل من يبني CHMP1B ثلاثة الموسومة حاتمة توزيع التحت خلوية مماثل (الشكل 3 G-I). وكان معظم الخلايا المصابة بالعدوى بالنقل العديد من حويصلي المسمى الهياكل حشوية دائرية / على خلفية من تلطيخ حشوية منتشر. في الخلايا تبين وجود نمط تمايز الخلايا العصبية أكثر، كان ينظر CHMP1B في عمليات محوار وفي بعض خلايا نهايات البعيدة من neurites التي كانت ملطخة بشدة بشكل خاص. بالإضافة إلى تلطيخ حشوية، أظهرت العديد من الخلايا منتشر تلطيخ النووي، مع عدد قليل من الخلايا وجود منقط تلطيخ النووي.

الموسومة حاتمة CHMP1B المشارك يموضع مع علامات endosomal

وكان جميع أفراد الأسرة CHMP من البروتينات درس حتى الآن على توطين التحت خلوية endosomal. درسنا ما إذا كان هذا صحيحا من CHMP1B من قبل المشترك، معربا عن عابر MYC-CHMP1B مع علامة endosomal، BD الألوان المعيشة ™ الموسومة GFP RhoB. شاهدنا ضرب شارك في توطين هذه العلامة وCHMP1B في الخلايا PC12 (الشكل 4 A-C) وكوس-7 الخلايا (لا تظهر البيانات). أكدنا على موقع endosomal من CHMP1B باستخدام علامات الأجسام المضادة لالإندوسومات في وقت مبكر (EEA1)، الإندوسومات في وقت متأخر (المانوز 6 فوسفات مستقبلات، M6PR) والجسيمات الحالة (مصباح 1)، في كوس-7 الخلايا. عابر. CHMP1B-GFP جزئيا شارك المترجمة مع M6PR (الشكل 4 D-F) وEEA1 (الشكل 4 G-I)، ولكن لم تظهر أي اضح المشارك التعريب مع Lamp1 (لا تظهر البيانات)، مشيرا إلى أن CHMP1B موجود على الإندوسومات المبكرة والمتأخرة، ولكن ليس الجسيمات الحالة.
http://hmg.oxfordjournals.org/conten...9/F4.small.gif
الرقم 4. حاتمة الموسومة CHMP1B المشارك يموضع مع علامات endosomal. (A-C) تظهر شارك في التعريب في متباينة جزئيا خلية PC12 transfected المشترك مع علامة endosomal RhoB-GFP (A) وMYC-CHMP1B (B). ملاحظة قوي شارك في التعريب في نهايات القاصي ملحقات محوار وفي منطقة محيط بالنواة (C). (D-L) تظهر خلايا كوس-7. (D-F) تظهر شارك في التعريب بين CHMP1B-GFP (D) ومستقبلات المانوز 6 فوسفات (M6PR) (E)، وهو علامة من الإندوسومات في وقت متأخر. للتوطين المشترك هو الجزئي (F). (G-I) تظهر شارك في التعريب بين CHMP1B-GFP (G) والاندوسوم أوائل مستضد 1 (EEA1) (H)، وهو علامة من الإندوسومات مبكرة. مرة أخرى، وشارك في توطين جزئية (I). (J-L) تظهر خلية كوس-7 مع transfected CHMP1B-GFP (J) وملطخة علامة فيليبين الكولسترول مجانا (K). وينظر تلطيخ فيليبين داخل الحويصلات CHMP1B-GFP المغلفة (L). الساحات ملونة يظهر في الزاوية اليمنى السفلي من كل صورة على نطاق والرمادي تشير إلى لون من تلك الصورة في الصورة اندمجت المقابلة (C، F، I و L). تم إصلاح الخلايا كوس-7 وتجهيزها للفحص المجهري 24 ساعة بعد ترنسفكأيشن وPC12 الخلايا 48 ساعة بعد ترنسفكأيشن.

يتم نقل الكوليسترول أسترته تناولها عن طريق مستقبلات LDL إلى المقصورة التقامي في وقت متأخر، حيث يتحلل إلى إطلاق سراح الكوليسترول مجانا. overexpression من بعض أفراد الأسرة CHMP في خلايا الثدييات يمكن أن تؤدي إلى تراكم غير طبيعي للالكولسترول مجانا في مقصورات endosomal (29). درسنا ما إذا كان هذا هو الحال عندما أعرب عن CHMP1B-GFP في كوس-7 الخلايا، وذلك باستخدام الكوليسترول محددة علامة فيليبين. كان هناك تلطيخ فيليبين من مجموعة فرعية من الحويصلات CHMP1B-GFP المسمى، على الرغم من أن قوة العلامات فيليبين في هذه الحويصلات لم تظهر زيادة بالمقارنة مع حويصلات إيجابية فيليبين في الخلايا untransfected (الشكل 4 J-L).

spastin الموسومة حاتمة المشارك يموضع مع البروتين endosomal RhoB

التفاعل المحتمل بين spastin وCHMP1B قادنا التحقيق في ما إذا spastin يمكن أن تكون أيضا موجودة على الإندوسومات. درسنا خلايا المشترك معربا عن RhoB الموسومة GFP-BD الألوان المعيشة مع MYC-Spastin ورأى مرة أخرى ضرب شارك في التعريب في كوس-7 (الشكل 5 A-C) والخلايا PC12 (الشكل 5 D-F). في الخلايا PC12، كان ينظر قوي شارك في التعريب في نهايات القاصي ملحقات محوار فضلا عن جسم الخلية (الشكل 5 D-F). في كل أنواع الخلايا، وأوضح الفحص أعداد كبيرة من الخلايا التي الرئيسين توطين كان مستقلة عن مرحلة دورة الخلية. أظهر تلوين الأجسام المضادة لا شارك في التعريب بين transfected منفردة، spastin الموسومة حاتمة وEEA1، M6PR أو مصباح 1 في كوس-7 الخلايا (لا تظهر البيانات).
http://hmg.oxfordjournals.org/conten...9/F5.small.gif
الرقم 5. حاتمة الموسومة المشارك يموضع spastin مع RhoB-GFP في كوس-7 وPC12 الخلايا. في (A-C)، واشترك في مع transfected RhoB-GFP (A) وMYC-Spastin (B) كوس-7 الخلايا. وينظر قوي شارك في التعريب بين RhoB وMYC-Spastin (C). (D-F) تظهر متباينة الخلايا PC12 transfected بالاشتراك مع RhoB-GFP (D) وMYC-Spastin (E). مرة أخرى، قوي شارك في التعريب واضح، سواء في خلايا الجسم وفي بؤر على طول امتدادات محوار (F، السهام). وكانت نهايات البعيدة من neurites التي كثيرا ما شارك الملطخة بشدة (السهم طويلة). الساحات ملونة يظهر في الزاوية اليمنى السفلي من كل صورة على نطاق والرمادي تشير إلى لون من تلك الصورة في المقابلة الصورة المدمجة (C و F). تم إصلاح الخلايا كوس-7 وتجهيزها للفحص المجهري 24 ساعة بعد ترنسفكأيشن وPC12 الخلايا 48 ساعة بعد ترنسفكأيشن.

، حاتمة الموسومة spastin المشارك يموضع مع CHMP1B الموسومة حاتمة في كوس-7 والخلايا PC12

قمنا بتحليل المقبل إلى أي مدى مترجمة شارك spastin وCHMP1B داخل خلايا الثدييات. درسنا، مع التجارب المناعي في عابر. كوس-7 وPC12 الخلايا، ما إذا كان هناك أي توطين المشترك بين spastin الموسومة حاتمة وحاتمة الموسومة CHMP1B. قارنا MYC-Spastin مع GFP-CHMP1B وCHMP1B-GFP، وMYC-CHMP1B مع GFP-Spastin وSpastin-GFP. في كل حالة spastin وCHMP1B البروتينات وبوضوح شارك المترجمة إلى منقط صغير أو هياكل حشوية أنبوبي (الشكل 6). على الرغم من ضرب، وكان لوحظ المشارك توطين بوضوح لم يكتمل، كما لوحظ spastin لربط مع مجموعة فرعية فقط من الهياكل إيجابية CHMP1B. ومن المثير للاهتمام، وتم ترتيب هياكل منقط اظهار spastin-CHMP1B شارك في توطين بعض الأحيان في المصفوفات الخطية، تذكرنا حويصلات النقل يصطفون على عناصر هيكل الخلية (المواد التكميلية، الشكل S1). وكانت هناك بعض الاختلافات في نمط شارك في توطين شهدت مع مجموعات مختلفة من البروتينات الانصهار، ولا سيما في كوس-7 الخلايا. في دراسات شارك في التعريب التي كانت MYC-CHMP1B مقابل البروتينات الانصهار spastin، كان معظم المشاركين في التعريب في الهياكل منقط والأنبوبية التي وزعت في السيتوبلازم محيط بالنواة وأكثر الطرفية (الشكل 6 A-F). وكان الحد الأقصى للمحيط بالنواة هياكل حويصلي ينظر عادة مع MYC-CHMP1B التعبير وحدها عادة غائبة. في دراسات شارك في توطين باستخدام CHMP1B-GFP، على الرغم من أن عثر منقط الطرفية شارك في الترجمة، وكان أقوى شارك في توطين عادة موجودة داخل الغطاء محيط بالنواة هياكل حويصلي (الشكل 6 G-I). في دراسات شارك في التعريب التي كانت GFP-CHMP1B، كان معظم المشاركين في توطين مرة أخرى في هياكل منقط والأنبوبية التي وزعت في السيتوبلازم محيط بالنواة وأكثر الطرفية (الشكل 6 J-L).
http://hmg.oxfordjournals.org/conten...9/F6.small.gif
الرقم 6. Spastin وCHMP1B البروتينات شارك توطين في خلايا الثدييات. و transfected خلايا كوس-7 عابر مع Spastin-GFP وMYC-CHMP1B (A-C)، GFP-Spastin وMYC-CHMP1B (D-F)، CHMP1B-GFP وMYC-Spastin (G-I) أو GFP-CHMP1B وMYC-Spastin (J-L). و transfected الخلايا PC12 عابر مع GFP-CHMP1B وMYC-Spastin (M-O). يشير السهم إلى المنطقة من شارك في التعريب في تمديد محوار. في كل transfections هناك شارك في توطين البروتينات اثنين. الساحات ملونة يظهر في الزاوية اليمنى السفلي من كل صورة على نطاق والرمادي تشير إلى لون من تلك الصورة في الصورة اندمجت المقابلة (C، F، I، L و O). تم إصلاح الخلايا كوس-7 وتجهيزها للفحص المجهري 24 ساعة بعد ترنسفكأيشن وPC12 الخلايا 48 ساعة بعد ترنسفكأيشن.

في الخلايا PC12، كانت spastin الموسومة حاتمة وCHMP1B شارك المترجمة في الهياكل منقط في إطار عمليات محوار، فضلا عن كونه في الهياكل منقط وأنبوبي في السيتوبلازم خلايا الجسم المترجمة المشترك (الشكل 6 M-O).

في المختبر والمجراة β-اكتاماز فحوصات البروتين جزء تكامل تدعم التفاعل الجسدي بين spastin وCHMP1B في خلايا الثدييات

درسنا كذلك أهمية الفسيولوجية للتفاعل الملحوظ بين spastin وCHMP1B باستخدام سلسلة من فحوصات البروتين β-اكتاماز جزء تكامل (PCAs). ويوفر هذا النهج طريقة محددة وحساسة مستقل لتقييم صلاحية الخميرة الأولية التفاعلات يومين الهجينة في نظام خلايا الثدييات (30 - 32). لأداء PCAs، وتفتيت البروتين β-اكتاماز في مجالين متكاملين وصف BLF1 (الأحماض الأمينية 24-197) وBLF2 (الأحماض الأمينية 198-288)، كما هو موضح سابقا (30، 31). عندما أعرب في عزلة هذه المجالات اثنين لا إعادة النشاط بيتا لاكتاماز بكفاءة. ومع ذلك، عندما يتم التعبير عن شظايا مكملة منفصلة اندماج في الإطار مع اثنين من البروتينات التفاعل يتم جلب اثنين من الأجزاء المكونة للانزيم β-اكتاماز الى مقربة، وتعزيز للطي المجال الصحيح وإعادة نشاط انزيم. وخلافا للنهج الخميرة اثنين الهجين، من المرجح أن تتفاعل في مكان التحت خلوية المعتاد شظايا البروتين.
وتنصهر البروتين CHMP1B المنبع من جزء BLF1 (CHMP1B-BLF1)، في حين أن تنصهر spastin المنبع من جزء BLF2 التكميلي (Spastin-BLF2). كما تحكم إيجابية ولدت لنا اثنين من بنيات أخرى في اثنين من مفارز (ATP6E وATP6G) للمضخة فجوي أتباز H + وتنصهر (V-أتباز) بروتين معقد المنبع من BLF1 وBLF2 شظايا، على التوالي (الشكل 7 A). وقد تم اختيار هذه البروتينات لأن هناك أدلة على أن تتفاعل جسديا في الجسم الحي (33)، وأنها تظهر ملامح التفاعل محددة للغاية في الخميرة المقايسات يومين الهجينة (28).
http://hmg.oxfordjournals.org/conten...ic-7.small.gifhttp://hmg.oxfordjournals.org/conten...ic-8.small.gif
الرقم 7. البروتين المقايسات تكامل. (A) تمثيل تخطيطي لستة بنيات استخدامها لتنفيذ بيتا لاكتاماز فحوصات البروتين جزء تكامل. BLF1 هو جزء N-محطة للانزيم β-اكتاماز ترميز الأحماض الأمينية 24-197، في حين BFL2 يتوافق مع المجال C النهائي للβ-اكتاماز الأحماض الأمينية الترميز 198-288. (B) بيانات من فحص PCA مقارنة النسبي أعيد النشاط β-اكتاماز مراعاتها عند و transfected الخلايا HEK293T عابر مع أي BLF1 + BLF2، CHMP1B-BLF1 + ATP6G-BLF2، ATP6E-BLF1 + ATP6G-BLF2 أو CHMP1B-BLF1 + Spastin البروتينات الانصهار -BLF2. تظهر أشرطة البيانات متوسط ​​ثلاثة قياسات مستقلة من كل من تجربتين شارك في ترنسفكأيشن منفصلة. (C) البيانات من فحص PCA مقارنة النسبي أعيد النشاط β-اكتاماز مراعاتها عند و transfected الخلايا HEK293T عابر مع أي ATP6E-BLF1 + ATP6G-BLF2، ATP6E-BLF1 + Spastin-BLF2، أو CHMP1B-BFL1 + Spastin-BLF2 الانصهار البروتينات. في كل حالة تم تحديد النشاط β-اكتاماز 48 ساعة بعد ترنسفكأيشن.تظهر أشرطة البيانات متوسط ​​ثلاثة قياسات مستقلة من كل من تجربتين شارك في ترنسفكأيشن منفصلة. (D-H) تظهر النتائج وجود في الجسم الحي β-اكتاماز البروتين جزء تكامل الفحص. خلايا HEK293T تم عابر شارك transfected مع BLF1 وBLF2 اندماج هو مبين في (A) وتفاعلات البروتين البروتين تم الكشف عن استخدام الجينات السترة ™ المقابلة في فيفو الكشف كيت (إينفيتروجن). ثمانية وأربعون ساعة بعد خلايا ترنسفكأيشن كانت محملة الخلية نفاذية الفلورسنت الركيزة CCF2 / AM تحتوي على اثنين fluorophores، الكومارين وفلوريسئين. في غياب أعيد النشاط β-اكتاماز تبقى الركيزة سليمة والإثارة من الكومارين في 409 نانومتر يؤدي إلى الحنق وانبعاث الضوء الأخضر من فلوريسئين في 520 نانومتر. في ظل وجود المعاد النشاط β-اكتاماز CCF2 / AM والمشقوق وتعطل الحنق مما يؤدي إلى انبعاث الضوء الأزرق من الكومارين في 447 نانومتر. الخلايا التي تحتوي إيجابي تفاعل البروتين البروتين يتألق الزرقاء، وتلك التي لا يتألق الأخضر. (I) النشاط β-اكتاماز وكميا في الجسم الحي عن طريق حساب العدد الكلي للخلايا الأخضر والأزرق في 10 مجالات مختلفة من الرأي في ترنسفكأيشن. (J) التمثيل البياني للنسبة المئوية من مجموع الخلايا إيجابية للنشاط β-اكتاماز من 10 حقول نظر.

في ثماني تجارب مستقلة لاحظنا باستمرار زيادة كبيرة في النشاط β-اكتاماز عندما كان CHMP1B-BLF1 والبروتينات الانصهار Spastin-BLF2 المشارك أعرب، بالمقارنة مع مستويات النشاط احظ عندما أعرب عن BLF1 غير مدمجة وشظايا BLF2 معا (الشكل 7 B). لاحظ مستوى النشاط β-اكتاماز عندما كان CHMP1B-BLF1 والبروتينات الانصهار Spastin-BLF2 المشارك أعرب كانت قابلة للمقارنة على نطاق واسع لتلك التي لوحظت عندما استخدمت السيطرة الإيجابية ATP6E-BLF1 وATP6G-BLF2 شظايا معا (الشكل 7 B وC). لاختبار خصوصية التفاعل CHMP1B spastin في هذا النظام، لاحظ النشاط β-اكتاماز النسبي عندما كانت CHMP1B-BLF1 وSpastin-BLF2 ومقارنة مع تلك التي يحصل عليها عندما إما CHMP1B-BLF1 أو Spastin-BLF2 بناء أعرب المشترك استعيض عن المقابلة ATP6E-BLF1 أو ATP6G-BLF2 بناء (الشكل 7 B و C). في كل حالة لاحظت مستوى النشاط β-اكتاماز تم تخفيض ملحوظ عندما تم استبدال شريك معين. وقد لوحظ نفس النمط من خصوصية في مكررات متعددة من هذه التجارب.
كنا بجوار أحد في الجسم الحي β-اكتاماز البروتين جزء تكامل فحص للتحقق من النتائج التي تم الحصول عليها من في المختبر الكلي المحللة الخلية β-اكتاماز الفحص. لفي الجسم الحي ويتم فحص في الخلايا الحية وحتى يوفر نهجا أكثر الفسيولوجية لاستكشاف البروتين البروتين التفاعلات (30، 31). و transfected الخلايا HEK293T على الشرائح غرفة زجاجية والنشاط β-اكتاماز وتصور في الجسم الحي باستخدام مجهر epifluorescence مقلوب. β-اكتاماز تم الكشف عن النشاط انبعاث مضان الأزرق، والذي يحدث في التحلل من الفلورة الركيزة CCF2 / AM، وتم تقييمها من قبل احتساب العدد الكلي للخلايا الزرقاء والخضراء في 10 حقول نظر. وكانت النتائج مشابهة جدا لتلك التي حصلت مع في المختبر فحص. مرة أخرى، لاحظنا باستمرار زيادة في النشاط β-اكتاماز عندما كان CHMP1B-BLF1 والبروتينات الانصهار Spastin-BLF2 المشارك أعرب، بالمقارنة مع مستويات النشاط احظ عندما أعرب عن BLF1 غير مدمجة وشظايا BLF2 معا (الشكل. 7 D، H-J). لاحظ مستوى النشاط β-اكتاماز عندما كان CHMP1B-BLF1 والبروتينات الانصهار Spastin-BLF2 المشارك أعرب كانت قابلة للمقارنة على نطاق واسع لتلك التي لوحظت عندما استخدمت السيطرة الإيجابية ATP6E-BLF1 وATP6G-BLF2 شظايا معا (الشكل 7 E ، وأنا وJ). تم تخفيض النشاط β-اكتاماز عندما تم استبدال إما CHMP1B-BLF1 أو بناء Spastin-BLF2 قبل المقابلة ATP6E-BLF1 أو ATP6G-BLF2 بناء (الشكل 7 F، G، I و J). تم نسخ هذه النتائج في ثلاث تجارب مستقلة. معا، في المختبر والمجراة β-اكتاماز فحوصات البروتين جزء تكامل تشير بقوة إلى أن التفاعل بين spastin وCHMP1B هو ذات الصلة من الناحية الفسيولوجية.

المقايسات المشترك مناعي دعم التفاعل بين spastin وCHMP1B في خلايا الثدييات

أجرينا التجارب المشتركة مناعي لمزيد من التحقق من أهمية الفسيولوجية للتفاعل بين spastin وCHMP1B. قمنا أولا بدراسات تجزيء التحت خلوية لتحديد ما إذا كان من الممكن أن تشارك في immunoprecipitate spastin وCHMP1B من الكسور الخلوية الذائبة. وأشارت تجزيء التحت خلوية من MYC-Spastin transfected كوس-7 الخلايا التي spastin موجود في عصاري خلوي، غشاء، النووي، في الغالب، في هيكل الخلية / الكسور التحت خلوية غير قابلة للذوبان (الشكل 8 A). كان CHMP1B-GFP توزيع التحت خلوية مماثل (الشكل 8 B)، ولم تغير توزيع التحت خلوية من البروتين إما بشكل ملحوظ عن طريق المشاركة في التعبير مع الآخرين (لا تظهر البيانات). على الرغم من أن التعبير عن كل بروتين كان أقوى في جزء غير قابلة للذوبان، بسبب الصعوبات التقنية المشترك مناعي من بيليه غير قابلة للذوبان، حاولنا شارك في مناعي من spastin وCHMP1B من الكسر للذوبان. نحن عابر شارك في اعرب Spastin MYC وCHMP1B-GFP أو MYC-Spastin وGFP ناقلات فارغة في الخلايا HEK293T. انفصلنا في MYC-Spastin / CHMP1B-GFP أو MYC-Spastin / خالي GFP لست] خلية كاملة إلى أجزاء قابلة للذوبان وغير القابلة للذوبان عن طريق الطرد المركزي. أكدنا أن البروتينات من الفائدة كانت موجودة في كل من اثنين من كسور القابلة للذوبان التي كتبها immunoblotting مع مكافحة MYC ومكافحة GFP الأضداد (الشكل 8 C و D)، ثم immunoprecipitated من الكسر للذوبان باستخدام الأجسام المضادة لمكافحة GFP. لاحقا غرب النشاف مع الأجسام المضادة لمكافحة MYC أظهرت أن MYC-Spastin كان شارك immunoprecipitated مع CHMP1B-GFP (الشكل 8 E)، ولكن هذا لا MYC-Spastin وشارك immunoprecipitated-من MYC-Spastin / خالي GFP ناقلات المشترك -transfection (الشكل 8 F). لم يتم الكشف عن MYC-Spastin في وهمية شارك في immunoprecipitations التي نفذت دون GFP الأضداد (الشكل 8 E و F).
http://hmg.oxfordjournals.org/conten...9/F8.small.gif
الرقم 8. MYC-Spastin هي في الغالب موجودة في جزء التحت خلوية غير قابلة للذوبان وشارك في immunoprecipitates مع CHMP1B. (A و B) Immunoblotting الكسور التحت خلوية من كوس-7 الخلايا المصابة بالعدوى بالنقل مع MYC-Spastin (A) أو CHMP1B-GFP (B)، وذلك باستخدام مكافحة MYC ومكافحة GFP الأجسام المضادة، على التوالي. ترتيب حارة في (B) كما هو مبين في الفقرة (أ). تقع عصابات المقابلة لأحجام المتوقعة لكلا البروتينات في جميع الكسور الخلوية الأربع، مع أسمى تعبير في جزء التحت خلوية تحتوي على عناصر هيكل الخلية ومكونات غير قابلة للذوبان الأخرى. وقد تم الحصول على الكسور التحت خلوية استخدام عدة بروتيوم التحت خلوية استخراج (Calbiochem)، بعد 48 ساعة ترنسفكأيشن الخلية. (C-F)، MYC Spastin المشارك immunoprecipitates مع CHMP1B-GFP. خلايا HEK293T وقد شارك transfected مع-MYC spastin وCHMP1B-GFP، أو كما تحكم، MYC-Spastin وفارغ ناقلات EGFP. بعد ثمانية وأربعين ساعة ترنسفكأيشن، كانت تحصد الخلايا في عازلة تحلل وتفصل إلى أجزاء قابلة للذوبان وغير القابلة للذوبان عن طريق الطرد المركزي. ويظهر التعبير عن البروتينات من حجم المتوقع في نسبة ذوبان من كل شارك في ترنسفكأيشن في (C) (MYC-Spastin / CHMP1B-GFP شارك في ترنسفكأيشن) و (D) (MYC-Spastin / فارغة ناقلات EGFP شارك في ترنسفكأيشن) . تم immunoprecipitated الصورتين القابلة للذوبان باستخدام الأجسام المضادة لمكافحة GFP، تم فصل البروتينات immunoprecipitated بواسطة SDS-PAGE ثم immunoblotted مع الأجسام المضادة لمكافحة MYC. لMYC-Spastin / CHMP1B-GFP شارك في ترنسفكأيشن،-Spastin MYC وشهدت الفرقة المقابلة لفي immunoprecipitate (E). لم يكن حاضرا هذه الفرقة عندما تم حذف الأجسام المضادة لمكافحة GFP من مناعي (E). في السيطرة MYC-Spastin / فارغ ناقلات EGFP مناعي، لم تكن هناك عصابات MYC Spastin الحالية (F).

تم بوساطة التفاعل بين spastin وCHMP1B من المنطقة N-الطرفية من spastin

درسنا التي كانت متواليات من الجزيء spastin المسؤولة عن التفاعل مع CHMP1B، وذلك باستخدام الخميرة اثنين الهجين الفحص. التي قطعناها على أنفسنا الخميرة اثنين الهجين "الطعم" التي تحتوي على كامل طول spastin، spastin مع حذف-C محطة إزالة المجال AAA كامل (spastinΔAAA)، spastin مع حذف N-محطة إزالة أول 194 الأحماض الأمينية من البروتين، بما في ذلك مجال MIT (spastinΔN1) وspastin مع الحذف-N محطة إزالة أول 80 الأحماض الأمينية وترك المجال MIT سليمة (spastinΔN2) (الشكل 2). على الرغم من أن فريسة CHMP1B تفاعلت بقوة مع من النوع البري spastin، spastinΔAAA وspastinΔN2 الطعم، فشل الطعم spastinΔN1 للتفاعل (الشكل 9).
http://hmg.oxfordjournals.org/conten...9/F9.small.gif
الرقم 9. يتم بوساطة التفاعل بين spastin وCHMP1B من منطقة spastin الذي يحتوي على مجال MIT. وأجري التحقيق في المجالات المسؤولة عن التفاعل بين spastin وCHMP1B خارج باستخدام الخميرة اثنين الهجين. العمود 1 يبين نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان ويسين (-U / L) لتحديد وجود كل من الطعم وناقلات فريسة. ويبين العمود 2 نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان، ليسين والحامض الاميني، الأمر الذي يتطلب تفعيل صاحب مراسل الجينات، في حين يبين العمود 3 نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان، ليسين والأدنين، الأمر الذي يتطلب تفعيل مراسل الجين أدي. في كل spastin قضية أو متحولة spastin كان يستخدم البروتين "الطعم"، في حين كان يستخدم CHMP1B باسم 'فريسة'. كامل طول spastin، spastinΔAAA وspastinΔN2 عن التفاعل مع CHMP1B، ولكن spastinΔN1 لا.

التعبير عن-حاتمة الموسومة CHMP1B يمنع تطوير microtubular النمط الظاهري الخلوية الشاذ المرتبطة أتباز معيب spastin

درسنا القادم تأثير التعبير عن CHMP1B على النمط الظاهري الخلوية microtubular الشاذة التي وصفت مع التعبير عن أتباز معيب spastin (13). ولدت لنا لبناء N-محطة الموسومة MYC التي تم حذف-C محطة نهاية تحتوي AAA-المجال كاملة من spastin (MYC-SpastinΔAAA، الشكل 2). ونحن أيضا بنيات الموسومة MYC N-الطرفية التي تحتوي على ثلاثة الطفرات مغلطة مختلفة، S362C، K388R وT615I. الطفرات S362C وK388R هي في الكاسيت أتباز وكما هو معروف الطفرة K388R لمنع وظيفة أتباز العادية. طفرة T615I هي في نهاية C-محطة القصوى من البروتين، خارج نطاق AAA. عندما عبرنا عن عابر هذه التركيبات في كوس-7 الخلايا، وجدنا العلامات المترجمة إلى منقط، والهياكل محيط بالنواة في الخلايا مع مستويات التعبير منخفضة (الشكل 10 A). ومع ذلك، مع المعتدلين (الشكل 10 ب) ارتفاع (الشكل 10 مستويات التعبير C)، وجدنا الهياكل الخيطية المسمى بارزة في جميع الخلايا تقريبا. هذه النتائج هي مشابهة جدا لأوصاف السابقة من النمط الظاهري الخلوية الناتجة عن التعبير عن spastin مع وظيفة أتباز المعيبة، واتسمت خيوط حزم كما ممدود بشكل غير طبيعي وسميكة من الأنابيب الدقيقة (13). التي قطعناها على أنفسنا أيضا بناء الموسومة MYC تحتوي على التغيير تسلسل S44L التي تم العثور عليها في ولاية متماثل في مريض واحد مع الشلل النصفي التشنجي، على الرغم من أنه ليس من الواضح ما إذا كانت الطفرة المسببة للمرض في هذه الحالة. كما ذكرت سابقا، فإن نمط التعبير عن هذا التصور لا يختلف عن النوع البري spastin (13).
http://hmg.oxfordjournals.org/conten.../F10.small.gif
الرقم 10. المشارك التعبير مع CHMP1B عكس النمط الظاهري الخلوية التي تسببها أتباز معيب spastin. (A-C) تظهر ثلاث خلايا منفصلة تبين مظاهر مختلفة من MYC-SpastinΔAAA transfected كوس-7 الخلايا. مع مستويات التعبير منخفضة، ويتركز MYC-Spastin في منطقة محيط بالنواة (A). مع زيادة مستويات التعبير، والخلايا لديها مختلطة الخيطية توزيع / منقط التسمية (B). مع ارتفاع التعبير، وهناك العديد من الهياكل الخيطية في السيتوبلازم (C). (D-F) تظهر مظهر نموذجي لكوس-7 transfected المشترك مع خلية CHMP1B-GFP (D) وMYC-SpastinΔAAA (E). ظهور الخيطية غير موجود وبقوة شارك المترجمة SpastinΔAAA وCHMP1B في هياكل دائرية. في بعض الأحيان، كانت الحويصلات حشوية أكبر ينظر أحيانا مع CHMP1B-GFP التعبير شارك الملطخة (السهم). تم العثور على نتائج مماثلة عندما أعرب عن نفس متحولة spastin مع GFP-CHMP1B وعندما أعرب عن MYC-SpastinK338R مع GFP-CHMP1B أو CHMP1B-GFP. وهناك نسبة صغيرة من الخلايا transfected شارك الإبقاء على النمط الظاهري الخيطية، وأظهرت مظهر نموذجي واحدة من هذه الخلايا في (G-I). نمط العلامات CHMP1B-GFP (G) وغيرت تماما عن تلك الموجودة عادة، وبدلا من ذلك بشدة شارك يموضع مع MYC-SpastinΔAAA المسمى خيوط (H وI). كان CHMP1B-GFP التعبير وحدها أي تأثير الإجمالي على الأنابيب الدقيقة بلمرة (J-L). الساحات ملونة يظهر في الزاوية اليمنى السفلي من كل صورة على نطاق والرمادي تشير إلى لون من تلك الصورة في الصورة اندمجت المقابلة (C، F، I و L). تم إصلاح الخلايا كوس-7 وتجهيزها للفحص المجهري 24 ساعة بعد ترنسفكأيشن.

لتقييم ما إذا CHMP1B التعبير تعديل النمط الظاهري الخلوية الشاذ المرتبطة المسوخ spastin، شاركنا اعرب GFP-CHMP1B أو CHMP1B-GFP مع كل بناء متحولة. في حالة MYC-SpastinΔAAA، MYC-SpastinK388R، MYC-SpastinS362C أو MYC-SpastinT615I يبني، أسفرت شاركت في التعبير مع أي CHMP1B بناء في خسارة كاملة من النمط الظاهري الخيطية تقريبا في جميع الخلايا التي كانت المشترك transfected. وقد شارك بقوة المترجمة للspastin متحولة مع CHMP1B في السيتوبلازم. في حالة CHMP1B-GFP، وكان هذا التعاون التعريب على هياكل دائرية بأحجام مختلفة داخل السيتوبلازم (الشكل 10 D-F). كان أقوى شارك في التعريب في الهياكل منقط الصغيرة، على الرغم من أن نسبة من الحويصلات أكبر ينظر أحيانا مع CHMP1B-GFP التعبير المزدوج المسمى أيضا. هذه الحويصلات أكبر ملطخة إيجابية مع فيليبين، مشيرة إلى أنها كانت الغنية بالكوليسترول ويعني أنهم كانوا من أصل endosomal (لا تظهر البيانات). في أقلية صغيرة من الخلايا transfected المشترك التي لم يكن لها ظهور الخيطية (~5٪ مقابل> 60٪ من الخلايا عندما أعرب عن متحولة spastin مستقل)، تم توزيعها CHMP1B ومترجمة شارك مع spastin متحولة على خيوط (الشكل. 10 G-I). المظاهر مع زملاء التعبير عن MYC-SpastinS44L مقابل GFP-CHMP1B أو CHMP1B-GFP لم تختلف عن المشاركة في التعبير عن CHMP1B يبني مع من النوع البري الموسومة حاتمة spastin (لا تظهر البيانات). وشوهد العديد من حزم أنيبيب من طول ما يبدو العادي وقطر عندما أبديت بنيات CHMP1B وحدها (الشكل 10 J-L).

وأعرب عن CHMP1B في دماغ الجنين وتعليم الكبار

ومن المتوقع CHMP1B أن تكون موجودة في أنسجة الجهاز العصبي المركزي، وإذا كانت التفاعلات بينه وبين spastin لها علاقة كبيرة في التنكس العصبي ينظر في HSP. حددنا به تسلسل أعرب (التكنولوجيات السليمة بيئيا) الموافق CHMP1B من خلال تنفيذ عملية بحث BLAST ضد قواعد البيانات EST الإنسان (34). وقد استمدت العديد من التكنولوجيات السليمة بيئيا، بما في ذلك طول كامل أو شبه cDNAs كامل طول (على سبيل المثال BX418704، BI596792) من الكبار أو مكتبات [كدنا مخ الجنين، مما يدل على أن يتم التعبير عن CHMP1B في الجهاز العصبي المركزي.

طفرة فحص CHMP1B في الأسر HSP

كما وجدنا دليلا قويا على أن CHMP1B شريك ملزم المحتمل لspastin، رأيناها CHMP1B وHSP مرشح الجينات المرض. لذا قمنا بها طفرة فحص الجينات في مجموعة من العائلات HSP. وCHMP1B كدنا] لديه تسلسل الترميز من 600 سنة مضت الموجه على الحمض النووي الجيني في اكسون واحد. لقد قمنا بتصميم الاشعال PCR لتضخيم التسلسل الجيني الترميز من الجينات، جنبا إلى جنب مع المرافقة DNA غير المشفر، في اثنين من شظايا متداخلة. وتضخمت هذه الشظايا من عينات الحمض النووي الجيني من أحد الأعضاء المتضررين من 25 عائلة مع HSP (في 23 منها نمط الميراث كان متوافق مع راثي الميراث المهيمنة، في اثنين متوافق مع الميراث مقهورة). تسعة عشر من هذه الأسر قد تم فرزهم لspastin الطفرات و 24 تم فرزهم لatlastin الطفرات، وكانت النتائج سلبية. تسلسل CHMP1B تضخيم شظايا كشف أي تغييرات تسلسل الترميز.

نقاش

شرعنا في التبصر وظيفة spastin، وهو بروتين تحور في HSP، من خلال تحديد الشركاء المحتملين ملزم. باستخدام نهج يومين الهجين الخميرة، حددنا تفاعل معين بين spastin وCHMP1B، وهو بروتين endosomal تشارك في أحداث المرور الغشاء. وقد دعمت أهمية فسيولوجية لهذا التفاعل في خلايا الثدييات بقوة من خلال ضرب شارك في توطين الموسومة حاتمة spastin مع CHMP1B، من خلال النتائج الإيجابية ومحددة في المختبر والمجراة β-اكتاماز البروتين جزء المقايسات تكامل والتعاون مناعي الدراسات. وبالإضافة إلى ذلك، شاهدنا آثار على توزيع التحت خلوية من الموسومة حاتمة من النوع البري وspastin متحولة مع التعبير عن CHMP1B. معا، تعطي هذه البيانات دعما قويا للتفاعل الفسيولوجية بين spastin وCHMP1B في خلايا الثدييات، مع التحذير من أن جميع التجارب التأكيدية تستخدم أنظمة overexpression. وهذا يعني أنه من الممكن أن بعض النتائج الإيجابية قد يكون الإفراط في التعبير القطع الأثرية والدراسات التي تهدف إلى إيجاد دليل على أهمية الذاتية للتفاعل spastin-CHMP1B أن تكون مفيدة.
وتدعم دراسة ملاحظاتنا السابقة بشأن توزيع الموسومة حاتمة من النوع البري spastin في كوس-7 الخلايا، مع الحاضر spastin في منقط أو الهياكل الأنبوبية داخل سيتوبلازم الخلية (13). بالإضافة إلى ذلك، نحن نقدم البيانات على توطين التحت خلوية من الموسومة حاتمة spastin في خط الخلية PC12 الفئران، خط خلية من خلايا ورم القواتم مشتق التي يمكن أن تكون متباينة في النمط الظاهري العصبية باستخدام عامل نمو الأعصاب (NGF). في الخلايا PC12 غير متمايزة، كان spastin الحاضر عن الهياكل منقط داخل السيتوبلازم. في الخلايا أكثر متباينة، كان spastin الحاضر مرة أخرى كما في نقاط وسوما، ولكن كان حاضرا في ملحقات محوار، مع أقوى تعبير غالبا في نهاية البعيدة للمحوار. هذا التوزيع هو مماثلة لتلك التي وصفها لspastin الذاتية في خط الخلية العصبية الحركية، حيث تم إثراء التعبير في المحور العصبي البعيدة والمناطق المتفرعة (11). ومع ذلك، فإنه يختلف عن نمط التعبير عن الموسومة FLAG من النوع البري spastin في العصبونات القشرية الفئران، حيث اقتصر التعبير إلى سوما ولم تمتد إلى محور عصبي أو التشعبات (14). أسباب هذا التباين ليست واضحة، ولكن يمكن أن تشمل آثار الخلية من نوع أو العلامة حاتمة معينة المستخدمة.
يميز هذه الدراسة أيضا للمرة الأولى توزيع التحت خلوية من CHMP1B ونحن نبين أن لديها نمط التعبير النووي وحشوية مختلطة في كوس-7 والخلايا PC12. في الخلايا PC12، تم العثور حشوية التعبير CHMP1B في الهياكل منقط في سوما الخلية، وأيضا في ملحقات محوار، مع نهايات البعيدة من neurites التي وصفت تظهر في كثير من الأحيان تعبير قوي. داخل سيتوبلازم كوس-7 الخلايا، وCHMP1B عادة موجودة في قبعة محيط بالنواة البؤري من الحويصلات وأكثر الطرفية، والهياكل منقط أصغر. وكانت حويصلات محيط بالنواة إيجابية على الأقل نسبة من CHMP1B الإندوسومات، لأنها تشارك الملون مع علامات الإندوسومات المبكرة والمتأخرة والكولسترول الوارد. وقد لوحظت بعض الاختلافات التي تعتمد على بناء في توزيع التحت خلوية من CHMP1B في كوس-7 الخلايا. وشوهدت القبعات محيط بالنواة هياكل حويصلي عادة مع MYC-CHMP1B وCHMP1B-GFP، ولكن ليس GFP-CHMP1B، في حين شوهدت الهياكل حويصلي حشوية تضخم غير طبيعي فقط مع CHMP1B-GFP. ومن المرجح أن تكون ثانوية بالنسبة للآثار الموقع وطبيعة العلامة حاتمة هذه الآثار. أحد التفسيرات المحتملة لهذه الملاحظات هو أن (ط) العلامة GFP N-محطة تعوق ملزمة لأغشية حويصلي، لذلك GFP-CHMP1B لا تسمية الهياكل حويصلي محيط بالنواة ينظر مع البروتينات الانصهار أخرى، (ب) علامة GFP-C محطة يسمح ملزمة لأغشية حويصلي ولكن يسبب تضخم غير طبيعي للالإندوسومات عن طريق منع إزالة CHMP1B، (ج) يسمح للN-محطة العلامة ج-MYC الظروف العادية ملزمة والعزل من الأغشية، مما أدى إلى حويصلات محيط بالنواة المسمى التي لم يتم الموسع. يمكن هذا التفسير أيضا شرح بعض الاختلافات التي تعتمد على بناء وجدنا في منطقتنا spastin-CHMP1B دراسات شارك في التعريب. في دراسات شارك في التعريب التي كانت MYC-CHMP1B مقابل البروتينات الانصهار spastin، كان معظم المشاركين في التعريب في الهياكل منقط والأنبوبية التي وزعت في السيتوبلازم محيط بالنواة وأكثر هامشية. وكانت مباراة محيط بالنواة هياكل حويصلي ينظر عادة مع MYC-CHMP1B عادة غائبة، مما يشير إلى أن التعبير spastin تسبب CHMP1B لتعبئتها من هذه البؤر الحويصلي. ومع ذلك، في دراسات شارك في توطين باستخدام CHMP1B-GFP، على الرغم من أن عثر منقط الطرفية شارك في الترجمة، وكان أقوى شارك في توطين الحالي عادة في الحد الأقصى محيط بالنواة هياكل حويصلي، مما يشير إلى أنه في هذه الحالة هو spastin التي يعاد توزيعها إلى غير متحرك CHMP1B. وقد وصفت آثار علامات حاتمة على وظيفة البروتينات CHMP (23). هذه الآثار يمكن أن تعتمد على طبيعة ومكانة العلامة، على الرغم من عدم قاعدة واضحة على النحو الذي به يكون لها تأثير سلبي المهيمن على وظيفة CHMP برزت حتى الآن.
عندما عبرنا عن مجموعة متنوعة من بنيات spastin أتباز معيبة في كوس-7 الخلايا، وجدنا نمط التعبير مطابقة لتلك التي سبق وصفها. وspastin متحولة أصبحت مرتبطة مع الهياكل الخيطية غير طبيعية، والتي تتكون من خيوط سميكة وممدود من الأنابيب الدقيقة (13). إلى حد كبير، وتبين لنا أن CHMP1B التعبير له آثار وخيمة على نمط التعبير عن أتباز معيب الموسومة حاتمة spastin. اختفت الهياكل الخيطية المسمى spastin من الخلايا، معربا عن المشترك فقط تقريبا، وبدلا من ذلك spastin متحولة بقوة شارك المترجمة مع CHMP1B. هذه الملاحظات، التي اتخذت مع حقيقة أن الخلايا معربا عن مستويات منخفضة من spastin أتباز معيب لا تظهر النمط الظاهري الخيطية، تشير إلى أن في هذه النماذج خلية spastin متحولة قد ربط الأنابيب الدقيقة مرة واحدة فقط مواقع ملزم للبروتينات أخرى، بما في ذلك CHMP1B، والمشبعة . التعبير عن CHMP1B خارجية المنشأ قد تزيد من مواقع الربط المتاحة، ومنع النمط الظاهري الخيطية من البلدان النامية. على الرغم من أن من غير المحتمل، لا يمكننا استبعاد تماما على إمكانية البديلة التي CHMP1B التعبير في حد ذاته يسبب أنيبيب إعادة التنظيم التي بدورها يمكن أن يكون لها تأثير غير مباشر على توزيع spastin.
رسمناها منطقة spastin التي تتفاعل مع CHMP1B كما الواقعة بين بقايا 80 و 196. Spastin معهد ماساتشوستس للتكنولوجيا النطاق تقع بين بقايا 116 و 194، التي تشكل أكثر من CHMP1B التفاعل المنطقة، ويبدو من المرجح أن المجال MIT هو المسؤول عن التفاعل بين spastin وCHMP1B. وهذا يتفق مع البيانات على ربط Vps4p إلى الإندوسومات في الخميرة، والذي يحدث عبر مجال MIT ويعتمد على وجود Vps2 وVps24، المتماثلات من CHMP2 البشرية وCHMP3 (22، 25). ولذلك يبدو أنه في حالتين على الأقل، spastin وVPS4، ملزمة لأحد أفراد الأسرة CHMP بوساطة المجال MIT. يبقى أن نرى ما إذا كان غيرها من البروتينات التي تحتوي على مجال MIT تتفاعل أيضا مع أفراد الأسرة CHMP، وإذا كان الأمر كذلك، ما إذا كان الفرق أو التفاعل عدائية من البروتينات التي تحتوي على مجال MIT مختلف مع البروتينات CHMP يمكن أن تكون آلية هامة لتنظيم المسار. منطقة التفاعل spastin مع CHMP1B منفصلة عن تلك المطلوبة للتفاعل مع الأنابيب الدقيقة، والتي تمت مؤخرا تم تحديدها على أنها واقعة بين بقايا 50 و 87 (11). وجود مواقع متميزة ملزمة لCHMP1B والتفاعل أنيبيب يتفق مع الحقائق التي لدينا CHMP1B لا يزال شارك توطين مع أتباز معيب spastin على خيوط، في تلك الخلايا نادرة المشترك معربا على حد سواء البروتينات التي تطور النمط الظاهري الخيطية.
الأسرة CHMP من البروتينات وتشارك كلها في أحداث المرور غشاء الخلايا، على الأقل، ولكن ربما ليس على سبيل الحصر، على مستوى الإندوسومات (24). الخميرة البروتينات آلية تبادل المعلومات والمتماثلات CHMP الإنسان تشكل، أو ترتبط ارتباطا وثيقا، ومجمع ESCRT-III، والتي قد تشكل العنصر الأخير من سلسلة من ثلاثة أجزاء التي تستهدف شحنات غشاء المرتبطة للجسم عديد الحويصلات (22). وليس من الواضح ما إذا كان CHMP1B هو جزء من مجمع ESCRT-III، أو ما إذا كان يلعب دور تنظيمي على وظيفة معقدة. في الوقت الحاضر، يمكننا التكهن فقط على دور وظيفي أن التفاعل spastin مع CHMP1B قد يستغرق. يتم تنظيم جمعية غشاء ESCRT-III CHMPs، بما في ذلك CHMP1B، من خلال VPS4، وهو بروتين AAA التي لديها أوجه التشابه مع spastin، لأن كلاهما يحتوي على مجال MIT وأعضاء من نفس AAA فرعية الأسرة (+22 - 25). كما يرتبط spastin هيكليا لVPS4، فمن الممكن أن تفاعلها مع CHMP1B قد تتخذ شكل تنظيم جمعية غشاء من هذا الجزيء بالمثل. في هذا السياق، من المثير للاهتمام أن وجدنا شارك التعبير من spastin مع MYC-CHMP1B بدا لتعبئة البروتين CHMP1B من توزيع حويصلي محيط بالنواة. بديل وإمكانية ربما أكثر بعد أن CHMP1B قد يكون لها وظائف المرتبطة تفاعله مع spastin التي تختلف عن دورها في حركة الغشاء.
وجدنا بعض التعبير CHMP1B في النواة. هذا النووية / نمط التعبير حشوية المختلط مماثلة لتلك التي وصفها لجزيء CHMP1A ترتبط ارتباطا وثيقا، والتي قد يكون لها شكل الإسوي النووي دورا في استقرار إسكات الجينات (27). على أساس نتائج هذه الدراسة، والعديد من الدراسات التي بحثت في توزيع التحت خلوية من spastin (7، 8، 10، 11)، يبدو من المرجح أن لديها أيضا النووي / توزيع هيولي مختلطة. وهكذا CHMP1B وspastin قد تقع في مجموعة من الجزيئات (التي استعرضت في 27) التي لها وظائف منفصلة في مسارات حركة الغشاء وفي النواة.
وهناك دور للspastin في الاتجار غشاء متوافق مع اقتراح أن spastin قد يكون لها دور في تنظيم أنيبيب (11، 13، 15). وبالنظر إلى الترابط الوثيق بين حركة البضائع متجهة الحويصلة والنقل بواسطة جزيئات السيارات على خيوط هيكل الخلية، فمن المتصور أن جزيء يشارك في أحداث المرور غشاء الخلايا قد تتفاعل أيضا مع الأنابيب الدقيقة أو يكون لها تأثيرات الثانوية على ديناميات أنيبيب، وبالفعل عدد قليل من هذه وقد وصفت جزيئات (إعادة النظر في 17). على هذه الخلفية، فمن المثير للاهتمام أن رأينا بؤر منقط من CHMP1B مترجمة شارك وspastin المنظمة على المصفوفات الخطية، تذكرنا الحويصلات التي يجري نقلها على الأنابيب الدقيقة. بل هو أيضا الجدير بالذكر أنه على الرغم من ذبابة الفاكهة spastin كان لها آثار على الأنابيب الدقيقة محور عصبي، كان نمط التعبير التحت خلوية من الأنابيب الدقيقة مستقرة وD-spastin متميزة، مع-D spastin بدلا شارك توطين-مع متشابك تجمع حويصلة علامة synaptotagmin (15). هذا ربما يشير إلى أن D-spastin قد يكون لها وظائف أخرى التي تختلف لتنظيم أنيبيب. سوف تكون هناك حاجة إلى مزيد من العمل لتشريح هذه القضايا.
إذا spastin لها دور في مسار التقامي، وهذا يثير مسألة كيفية خلل في هذه العملية قد تؤدي إلى HSP النمط الظاهري الاعصاب. مسار التقامي دورا هاما في تنظيم غشاء المرتبطة المستقبلات، مع تنظيم مستقبلات أن تعتمد على التوازن بين تدهور في المقصورة lumenal للعديد الحويصلات الجسم / يحلول مقابل إعادة التدوير إلى غشاء البلازما (19). شذوذ الفرز في مسار التقامي قد يؤدي في المستقبل حتى- أو لأسفل التنظيم. ولذلك يمكن خلل في مسار التقامي يسبب تشوهات متعددة في مستويات مستقبلات غشاء البلازما ويترتب على ذلك خلل في الإشارات، وربما بما في ذلك تفعيل مسارات أفكارك، أو قمع مسارات البقاء على قيد الحياة. نهايات البعيدة من المحاور طويلة جدا قد تكون عرضة بشكل خاص لهذه العملية، لأن مسارات المصب قد يكون بالفعل تعمل على المستويات الدنيا تقريبا في مثل هذه البيئة القاسية. والاحتمال الآخر هو أن الشذوذ في حركة endosomal قد التشويش على إشارات مباشرة المصب، بغض النظر عن مستويات مستقبلات غشاء البلازما. صيانة الخلايا العصبية تعتمد على عوامل بقاء عصبية الصادرة عن أهداف تعصيب. هذه العوامل بقاء إشارة من قبل تنشيط مستقبلات وما شابه ذلك على الغشاء قبل المشبكي الخلايا العصبية (35). على الأقل في بعض الخلايا العصبية NGF إشارات يمكن نقلها في الإندوسومات المتخصصة الأولى التي يتم نقلها إلى جسم الخلية العصبية بواسطة وسائل النقل محور عصبي الوراء (35، 36). وبالتالي يمكن أن فشل الاتجار الاندوسوم يشير تؤدي إلى تنكس عصبي، والخلايا العصبية مرة أخرى مع محاور عصبية طويلة جدا يمكن أن تكون عرضة لتشوهات من هذا النوع من العمليات.
هناك أدلة متزايدة على أن العيوب في وظائف ذات الصلة النقل داخل الخلايا وحركة الغشاء قد تكون آليات مشتركة لالتنكس العصبي ينظر في HSP. قد تورطت عدة بروتينات HSP في النقل الجزيئي، بما في ذلك الخلايا العصبية محددة كينيسين السلسلة الثقيلة KIF5A (37 - 39)، أو أحداث المرور الغشاء، بما في ذلك alsin، atlastin، maspardin، spartin وNIPA1 (غير مطبوع في Angelman's1) (16 ، +40 - 46). على نطاق أوسع، وتحليل أسباب الأمراض الوراثية من LMNs يشير إلى أنها هي أيضا عرضة للعيوب في النقل داخل الخلايا أو حركة الغشاء، مع المحرك كينيسين KIF1Bbeta، خيط عصبي ضوء سلسلة، المتعلقة myotubularin 2 بروتين الفوسفاتيز، gigaxonin والبروتينات Rab7 يجري كل المتورطين في هذه العمليات (+47 - +52).
وباختصار، فإننا نقدم البيانات التي نقترح بقوة على التفاعل في خلايا الثدييات بين spastin وCHMP1B. هذه النتائج تدعم فكرة أن spastin يلعب دورا في حركة الغشاء، وتسهم في اعتراف الناشئة التي عيوب في آليات النقل والمرور غشاء الخلايا هي سبب كبير من الخلايا العصبية الحركية علم الأمراض.

المواد والأساليب

بناء الخميرة اثنين الهجين والمناعي ناقلات

وتضخمت الإطارات القراءة مفتوحة كاملة من spastin وCHMP1B كل قراءة دليل PFX البلمرة (إينفيتروجن) PCR من الحيوانات المستنسخة IMAGE 4829087 و3928338، على التوالي، وذلك باستخدام بوابة ™ (إينفيتروجن) إعادة التركيب استنساخ الاشعال المتوافقة مع نظام مصمم من تسلسل [كدنا مرجعية لكل جين. لتوليد spastinΔAAA، spastinΔN1 وspastinΔN2 المسوخ، PFX أجريت PCR خارج باستخدام المناسبة عبارة (إينفيتروجن) إعادة التركيب استنساخ الاشعال المتوافقة مع نظام مصمم من داخل كدنا] إشارة. ولدت متحولة spastin T615I بواسطة PCR باستخدام التمهيدي العكسي الذي تضمن تغيير تسلسل المناسب. تم إنشاء أشكال متحولة أخرى من spastin باستخدام الربط عن طريق التداخل منهج الإرشاد، كما هو موضح سابقا، مرة أخرى باستخدام عبارة (إينفيتروجن) إعادة التركيب استنساخ الاشعال المرافقة المتوافقة مع نظام (53). تم بناء ناقلات دخول بوابة نظام إعادة التركيب استنساخ pENTR201 و / أو pENTR207 تحتوي على cDNAs تضخيم وفقا لتعليمات الشركة الصانعة. تم التحقق من تسلسل الدخول يبني ناقلات بواسطة التسلسل على ABI377 أو 3700 المنظم، وذلك باستخدام BigDyeDT الكيمياء (النظم البيولوجية التطبيقية).
ثم تم subcloned وspastin وCHMP1B من النوع البري محاضر في ناقلات بوابة المتوافقة مع pcDNA3-NG-MYC، PE-GFP-N وPE-GFP-C، الذي تضمن 5'-MYC، 3'-GFP أو 5'-GFP الحواتم، على التوالي. تم subcloned بنيات متحولة Spastin في ناقلات بوابة متوافق مع pcDNA3-NG-MYC. تم التحقق من التوجه للتسلسل spastin وCHMP1B داخل بنيات بواسطة التسلسل المباشر على ABI377 أو 3700 المنظم، أو عن طريق PCR مع تركيبات مناسبة للناقلات وإدراج بادئات محددة التسلسل.
لخميرة التجارب يومين الهجينة، وsubcloned والتي تحتوي على spastin pENTR201 دخول المتجه إلى ناقلات الطعم بوابة متوافق مع pGBDU-G، والتي تم بناؤها من قبل استنساخ قراءة بوابة إطار كاسيت B إلى pGBDU-C1 (54) وفقا لتعليمات الشركة الصانعة .

الخميرة يومين الهجينة فحص مكتبة ومراسل المقايسات

PJ69-4A سلالة الخميرة (حصيرة على trp1-901 leu2-3، 112 ura3-52، his3-200 gal4Δ gal80Δ LYS2 :: GAL1-HIS3 GAL2-ADE2 met2 :: GAL7-lacZ (54)) تحولت بواسطة الصعق الكهربائي (55 ) مع البلازميد الطعم، والتي تحمل URA3 علامة. لم يتم الحصول على تنشيط الذاتي للجينات مراسل سلالة الطعم على الاصطناعية التسرب (SD) -Ura / أدي وSD -Ura / صاحب. تم عرض الطعم spastin ضد K562 erythroleukaemia مكتبة كدنا] صانع عيدان الثقاب (Clontech)، الذي يحتوي على LEU2 علامة، وتتضخم وتتحول إلى نوع التزاوج تحول، MAT α مشتق من سلالة PJ69-4A الخميرة. وتمثل هذه المكتبة 3.5 × 10 6 استنساخ مستقلة مع الحجم المقدر إدراج [كدنا تتراوح 0،4-3،8 كيلو بايت، مع متوسط ​​حجم إدراج 1.9 كيلوبايت.
الخميرة الطعم (~10 9 وت) وتزاوج بشكل فردي إلى المكتبة فريسة الخميرة (~6 × 10 8 كفو) باستخدام إجراء لوحة التزاوج معدلة من طريقة موضح سابقا (56). أعطى هذا التزاوج من الكفاءة> 2٪، مما يتيح تغطية ~4 أضعاف من المكتبة. وقد نمت خليط من التزاوج على 16 × 150 مم SD لوحات -Ura / لوي / أدي لمدة تصل الى 2 أسابيع لاختيار من الحيوانات المستنسخة معربا عن ADE2 المراسل. تم القبض على المستعمرات في شكل 96-الشبكة على لوحات SD -Ura / لوي / آدي هذه أن كل معالجة لاحقة يمكن أن يؤديها باستخدام المكرر 96 دبوس. تفعيل lacZ كان يعاير مراسل التي تنمو الخميرة على ورق الترشيح على لوحات YPAD بين عشية وضحاها، الناشر الخلايا في النيتروجين السائل ثم يحتضنها المرشحات عند 37 درجة مئوية لمدة 1 ساعة على مرشحات مسبقا غارقة في 6 مل Z العازلة (100 متر م نا 2 هبو 4، 40 م م ناه 2 PO 4، 10 م م بوكل، 1 م م MgSO 4، ص 7)، و 100 ميكرولتر 4٪ X-غال و 11 ميكرولتر β المركابتويثانول. وسجل المستعمرات بأنها إيجابية لتفعيل lacZ إذا كان التلون أكبر من أن الخميرة التي تحتوي على ناقل الطعم وحده. نحن لم يسجل لتفعيل HIS3 الجينات لأنه في تجربتنا> 99٪ من المستعمرات التي تنشط ADE2 أيضا تفعيل HIS3، كما ذكرت سابقا (54).

تحديد البروتينات التفاعل في الخميرة الشاشتين الهجين

وتضخمت إدراج فريسة مباشرة من الخميرة باستخدام بادئات ناقلات محددة. تم القبض على مستعمرات الخميرة إلى 20 م م هيدروكسيد الصوديوم و lysed لمدة 20 دقيقة في درجة حرارة الغرفة. تمت إضافة قسامة 1.5 ميكرولتر من مزيج تحلل لمعيار 25 ميكرولتر PCR رد فعل تحتوي على الاشعال ناقلات محددة. كانت ساخنة تفاعل PCR لمدة 5 دقائق في درجة حرارة 95 درجة مئوية تليها 35 دورات من 1 دقيقة تمسخ في 95 ° C، 1 دقيقة الصلب في 58 ° C و 3.5 دقيقة التمديد في 72 ° C. تم تشغيل أربعة microlitres من كل تفاعل PCR على 0.8٪ هلام الاغاروز لتقدير حجم إدراج. للتعرف على إدراج فريسة، والتسلسل 3-5 ميكرولتر من كل منتج PCR كما هو موضح أعلاه.

إعادة تأكيد وخصوصية اختبار الخميرة المقايسات يومين الهجينة

لإعادة اختبار كل تفاعل في الخميرة الطازجة، تم استنساخ كل منتج PCR فريسة باستخدام بوابة نظام إعادة التركيب الاستنساخ في بوابة متوافق pGAD-G ناقلات، كما هو موضح أعلاه. المختصة MAT تحولت α خلايا الخميرة PJ69-4A بواسطة الصعق الكهربائي (55) مع كل من هذه فريسة متجه تحتوي على البلازميدات ومطلي مباشرة على SD -Leu لوحات. بعد النمو عند 30 درجة مئوية لمدة 3 أيام، وكانوا تزاوج بواسطة الطلاء طبق على حشيش MAT الخميرة التي تحتوي إما على الطعم ذات الصلة، واثنين من الطعوم ذات صلة مختلفة أو الطعم متجه فارغة، ثم حضنت ل> 5 ساعات على لوحات YPAD. وقد تم اختيار Diploids على SD -Ura / لوي قبل الاختبار لتفعيل مراسل عن طريق تكرار على SD -Ura / لوي / آدي.

التحليل الحسابي

كما تم البحث في تسلسل فريسة ضد الإصدارات التي تعقد محليا من الانسان العاقل Unigene وقواعد البيانات EMBLminus باستخدام BLAST الآلي (34) الخوارزمية. استخدمت بنيت خصيصا حدات بيرل والكتابات على prefilter وتنسيق الإخراج BLAST الخام، وتحديد ما إذا كان تسلسل 5 'قراءة تتداخل مع منطقة ترميز البروتين من الجين. مباريات فقط لمناطق ترميز البروتين المعروف والتكنولوجيات السليمة بيئيا التي لم تدرج إطار القراءة المفتوح الذي يعرف بأنه ايجابيات. تم استبعاد مباريات ل3 'UTRs والحمض النووي الجيني مع عدم وجود التنبؤ الجينات المرتبطة بها. مفرد، استبعدت التكنولوجيات السليمة بيئيا unspliced ​​التي لم تتوافق مع أي توقعات الجينات أيضا، لأنها ربما تمثل التلوث الجيني للمكتبات كدنا].

الأجسام المضادة

تم الحصول على الأجسام المضادة الأولية لمكافحة MYC وحيدة النسيلة (الماوس استنساخ 4A6) من Clontech. وقد تم الحصول على وحيدة النسيلة الأجسام المضادة لمكافحة أنيبيب (الفئران استنساخ YL1 / 2) ومكافحة GFP الأضداد الأرنب بولكلونل من abcam (كامبردج). EEA1، كانت M6PR وLamp1 الأجسام المضادة هدية عينية من بول Luzio (كامبردج). تم الحصول على الأجسام المضادة الثانوية مترافق البيروكسيد عن النشاف الغربي من سيجما. تم الحصول على الأجسام المضادة الثانوية للالمناعي من جاكسون ImmunoResearch، وشركة

زراعة الخلايا، وترنسفكأيشن المناعي

وكانت المصنفة خلايا كوس-7 على coverslips زجاجية معقمة في ست لوحات جيدة (~2.5 × 10 5 خلايا / جيد). بعد 24 ساعة و transfected الخلايا مع ~400 نانوغرام من الحمض النووي ناقلات، وذلك باستخدام Effectene ® كاشف ترنسفكأيشن (QIAGEN)، وفقا لتعليمات الشركة الصانعة. بعد ترنسفكأيشن، وحضنت الخلايا لمدة 24 أو 48 ساعة في المعدل المتوسط ​​النسر Dulbecco و(DMEM) (لايف تكنولوجيز) التي تحتوي على 10٪ مصل بقري جنيني (FBS) (LABTECH الدولية)، و 100 U / البنسلين مل و 100 ميكروغرام / مل الستربتومايسين (الحياة تكنولوجيز). كانت خلايا غير متمايزة PC12 مثقف في DMEM تحتوي على 10٪ مصل الحصان (HS)، و 5٪ FBS و 1٪ البنسلين والستربتومايسين (لايف تكنولوجيز). وكانت المصنفة الخلايا في 1 × 10 5 إلى ست لوحات جيدة تحتوي على coverslips الزجاج المطلي مسبقا مع بولي د -Lysine (سيغما). كانت خلايا غير متمايزة ثم إما عابر مع transfected Effectene ® ترنسفكأيشن الكاشف (QIAGEN)، وفقا لتعليمات الشركة المصنعة لمدة 48 ساعة أو عابر transfected تليها التمايز مع 50 نانوغرام / مل NGF (سيغما) في انخفاض DMEM مصل يحتوي على 1٪ HS و 0.5٪ FBS. كانت خلايا متباينة مثقف في NGF تحتوي على وسائل الإعلام لمدة 48 ساعة على الأقل بعد ترنسفكأيشن.
بعد ترنسفكأيشن، وكانت تغسل الخلايا في برنامج تلفزيوني (الحياة تكنولوجيز) وثابت مع 3.8٪ امتصاص العرق و 4٪ السكروز في برنامج تلفزيوني في درجة حرارة الغرفة لمدة 15 دقيقة. وجرفت المياه خلايا ثابتة في برنامج تلفزيوني قبل permeabilized في برنامج تلفزيوني يحتوي على 0.1٪ تريتون X-100 (سيغما) أو 0.05٪ سابونين (سيغما) في درجة حرارة الغرفة لمدة 5 دقائق. خلايا Permeabilized ثم تم غسلها ثلاث مرات في برنامج تلفزيوني، المحتضنة لمدة 15 دقيقة في عرقلة الحل (PBS، و 10٪ FBS، ± 0.05٪ سابونين) ومن ثم نقلها إلى عرقلة الحل الذي يحتوي على الأجسام المضادة حاتمة محددة المناسب في التخفيف المناسبة. بعد 60 دقيقة الحضانة، وكانت تغسل coverslips ثلاث مرات في عرقلة الحل ثم تم حضنت لمدة 60 دقيقة في عرقلة العازلة التي تحتوي على الأجسام المضادة الثانوية المناسبة، بتركيز 1/100. تم زلات غطاء ثم يغسل ثلاث مرات في برنامج تلفزيوني ومرة واحدة في H المقطر 2 O، وبعد ذلك تم تركيبه في Vectorshield ™ (ناقلات مختبرات شركة) المتوسطة على شريحة زجاجية. وقد تم تحليل عينات الملون على المجهر نيكون الكسوف E800 وبيو راد microradience معدات تحليل متحد البؤر. وسجلت الصور باستخدام برنامج الليزر-حاد OS2 وتمت معالجة البيانات في وقت لاحق باستخدام برامج أدوبي فوتوشوب و Microsoft PowerPoint.

بيتا لاكتاماز البروتين جزء تكامل فحص

بيتا لاكتاماز كدنا] يبني.

الجينات المقاومة الأمبيسلين (بلوخ كانت تستخدم) كهدف لPCR اثنين شظايا β-اكتاماز، BLF1 (الأحماض الأمينية 24-197) وBLF2 (الأحماض الأمينية 198-288)، وذلك باستخدام الأمام وعكس الاشعال تحتوي على تقييد مواقع التوقيت الصيفي الباسفيكي الأول وXho I ، على التوالي. [أليغنوكليوتيد التكميلية التي تحتوي على العديد من المواقع الفريدة تقييد (هند III، هبانالباسيفيكي الأول وXho I) والترميز في إطار ل15 الأمينية الحمضية ببتيد مرونة رابط (GGGGS) 3 تم تهجين معا وligated إلى pcDNA3.1 / زيو (+ ) خطي مع هند الثالث وXho I. تم ligated BLF1 وBLF2 شظايا β-اكتاماز بين التوقيت الصيفي الباسفيكي الأول وXho المواقع أنا المصب وفي الإطار مع (GGGGS) 3 رابط لإعطاء متجهين منفصلة معربا عن شظايا مختلفة من الجين β-اكتاماز (pcDNA3.1 / زيو (+ ) (GGGGS) 3 BLF1 وpcDNA3.1 / زيو (+) (GGGGS) 3 BLF2). والمنبع هبان كان يستخدم موقع I إلى ligate بوابة القراءة إطار كاسيت (RF B). واستخدمت هذه العبارة القراءة إطار كاسيت لligate إما بالطول CHMP1B الإنسان أو المنبع spastin من BLF1 في pcDNA3.1 / زيو (+) (GGGGS) 3 أو BLF2 في pcDNA3.1 / زيو (+) (GGGGS) 3. وتم التحقق من جميع البناءات في إطار وأكد من تسلسل الحمض النووي.

β-اكتاماز بمساعدة بروتين تكامل فحص اللونية.

واستند الفحص على الطريقة الموصوفة سابقا (30، 31)، مع تعديلات طفيفة. تم تقسيم الخلايا HEK293T 24 ساعة قبل ترنسفكأيشن والمصنف عند 2.5 × 10 5 في 12 لوحات جيدة (نونك ™) في DMEM تحتوي على 10٪ FBS و 1٪ البنسلين والستربتومايسين. و transfected خلايا عابر مع 300 نانوغرام من الحمض النووي البلازميد باستخدام Effectene® ترنسفكأيشن الكاشف (QIAGEN) وفقا لتعليمات الشركة الصانعة. تم غسلها ثمانية وأربعين ساعة بعد خلايا ترنسفكأيشن مرتين مع برنامج تلفزيوني وإعادة علقت في 100 ميكرولتر من 100 م م الفوسفات عازلة درجة الحموضة 7.4 ثم هي lysed من قبل ثلاث دورات تجميد ذوبان الجليد من خلال تجميد في الثلج الجاف / الإيثانول لمدة 10 دقيقة والذوبان في 37 ° C حمام الماء لمدة 10 دقيقة. وبعد ذلك تستخدم الكلي المحللة خلية لاختبار النشاط β-اكتاماز في 96 لوحات جيدة (الصقر ®). مائة microlitres 100 م م العازلة أضيف الفوسفات 7.4 درجة الحموضة إلى كل بئر من 96 لوحة جيدا لتركيز النهائي من 60 ملم تحتوي على 20 ميكرولتر من مجموع الخلايا المحللة و2 ميكرولتر 10 م م Nitrocefin (بيكتون ديكنسون والشركة، سباركس، MD؛ النهائي تركيز 100 μ م) والمخفف إلى 200 ميكرولتر مع الماء منزوع الأيونات. ويعاير عينات في ثلاث نسخ باستخدام قارئ لوحة فيوجن ™ ألفا العالمي (بيركن إلمر الآلات ™) مزودة 485 نانومتر (20 نانومتر عرض النطاق الترددي) مرشح في وضع الامتصاص.
تم حساب معدلات التحلل Nitrocefin من كيد مجموعة خطية من زيادة امتصاص رصدت أكثر من 60 دقيقة. تم تطبيع البيانات من محتوى البروتين الكلي المحللة الخلية التي يحددها بيو راد فحص البروتين (بيو راد) استنادا إلى طريقة برادفورد (57).

في الجسم الحي β-اكتاماز البروتين مضان جزء تكامل الفحص.

تم تقسيم الخلايا HEK293T 24 ساعة قبل ترنسفكأيشن والمصنف عند 2.5 × 10 5 لكل بئر في 2 جيدا الشرائح غرفة زجاجية (نونك ® مختبر التكنولوجيا II نظام الشرائح غرفة) في DMEM تحتوي على 10٪ FBS و 1٪ البنسلين والستربتومايسين. و transfected خلايا عابر مع DNA البلازميد 300 نانوغرام باستخدام Effectene ® ترنسفكأيشن الكاشف (QIAGEN) وفقا لتعليمات الشركة الصانعة. وبعد مرور ثمانية وأربعين ساعة تم غسلها خلايا مرة واحدة مع برنامج تلفزيوني ومعلق في 750 ميكرولتر هانك محلول ملحي متوازن (HBSS) (لايف تكنولوجيز). β-اكتاماز النشاط ثم تم الكشف باستخدام أدوات الكشف GeneBLAzer ™ (إينفيتروجن) وفقا لتعليمات الشركة الصانعة. بعد إضافة الخلية الفلورة الركيزة منفذة CCF2 / AM، حضنت الشرائح الغرفة لمدة 1 ساعة محمية من الضوء ومن ثم تصور لمضان. تم إجراء الفحص المجهري مضان من الخلايا HEK293T الحية على الشرائح الزجاجية الغرفة باستخدام أوليمبوس IX81 مجهر مقلوب برنامج التحصين الموسع ومضان مع 40 × موضوعي (أوليمبوس). تم تنفيذ الاستحواذ في وقت واحد من مضان اللونين في الوقت الحقيقي باستخدام 400DF15 مرشح الإثارة والمزدوجة عرض نظام التصوير ™ (رؤى بصرية)، التي تحتوي على مكعب التصفية التي كان 450DF65 و535DF35 المرشحات الانبعاثات (OMEGA الضوئية). خلية ∧ تم استخدام برامج التصوير R (أوليمبوس) لتحليل الصور متعدد الألوان. تقدير حجم النشاط β-اكتاماز في الجسم الحي أجري عن طريق حساب عدد الخلايا الزرقاء والخضراء في 10 حقول نظر من كل المفترض البروتين البروتين التفاعل الاقتران.

التحليل المشترك مناعي من Spastin CHMP1B التفاعلات

خلايا HEK293T مع transfected spastin. Myc على وCHMP1B-GFP وحده أو شارك في transfected مع spastin. Myc على وCHMP1B أو spastin. Myc على وEGFP-C1 تم غسلها مرتين مع PBS و lysed في 600 ميكرولتر المنظفات NP40 العازلة التي تحتوي على 1٪ (ت / ت ) NP-40، 150 م م كلوريد الصوديوم، و 10 م م تريس، حمض الهيدروكلوريك (pH7.5)، 0.02٪ أزيد الصوديوم، 1 ملغ / مل BSA و 0.5٪ مثبط البروتياز كوكتيل. تم إزالة أحد aliquote من 100 ميكرولتر من كله جزء المحللة الخلية وال 500 ميكرولتر المتبقية طرد في 000 13 غرام لمدة 15 دقيقة على 4 درجات مئوية. ثم إزالة جزء القابلة للذوبان وحضنت مقتطفات بين عشية وضحاها في 4 درجات مئوية مع الأجسام المضادة الأولية الأرنب بولكلونل مكافحة GFP (abcam) بتركيز 1: 250. خمسون microlitres من 50٪ بروتين الخرز A-سيفاروز ثم أضاف وحضنت مع مجمعات للبروتين الأجسام المضادة لمدة 2 ساعة عند 4 درجات مئوية. والخرز ثم عزل عن طريق الطرد المركزي وجيزة وغسلها ثلاث مرات في NP-40 العازلة التي تحتوي على BSA مع غسل النهائي في NP-40 العازلة دون BSA. ثم تم معلق حبات في 5 × SDS-PAGE العازلة عينة ويسخن لمدة 5 دقائق عند 95 ° C. تم حل البروتينات ملزمة SDS-PAGE وimmunoblotted مع الماوس وحيدة النسيلة المضادة للMyc على استنساخ 4A6 الأجسام المضادة الأولية بتركيز 1: 250 (ريف).

تجزيء التحت خلوية

تم تقسيم خلايا كوس-7 24 ساعة قبل ترنسفكأيشن والمصنف في 0.75 × 10 6 لكل لوحة في 10 سم أطباق الثقافة. بعد مرور أربع وعشرين ساعة أنهم و transfected باستخدام Effectene® ترنسفكأيشن الكاشف (QIAGEN). بعد ثمانية وأربعين ساعة ترنسفكأيشن، تم تنفيذ تجزئة التحت خلوية من استخدام عدة استخراج بروتيوم التحت خلوية (Calbiochem)، وفقا لبروتوكول الشركة المصنعة للخلايا ملتصقة. حيث أصبحت بعض الخلايا غير ملتصقة خلال البروتوكول، ونسج عصاري خلوي، الغشاء والكسور النووية في 750 غرام، 5500 ز و6800 غرام، على التوالي، لمدة 10 دقيقة في 4 درجات مئوية، لإزالة أي تلوث من الكسور في وقت لاحق. تم حل البروتينات بواسطة SDS-PAGE وimmunoblotted مع الأجسام المضادة المناسبة.

PCR وتسلسل الحمض النووي الجيني

منحت الموافقة الأخلاقية من قبل لجنة أخلاقية نفيو أدينبروكس. تم تضخيمه تسلسل الترميز، مع المرافقة تسلسل الجينوم، من اكسون CHMP1B واحد عن طريق PCR والتسلسل في اثنين من شظايا متداخلة. وقد أجريت PCR وتسلسلها من كما هو موضح سابقا (37). وكانت تسلسل التمهيدي تستخدم لتضخيم اثنين شظايا CHMP1B من الحمض النووي الجيني: F1: GCTCTGACGTCACCACCTG، R1: CGAATTTGTCCATCAAAGCA، F2: AACATGGAAGTTGCGAGGAT، R2: GGTAGAAGGGCATTTCAGCA.

المواد التكميلية

المواد التكميلية متوفرة في HMG على الانترنت.

شكر وتقدير

نشكر العائلات الذين وافقوا التكرم المشاركة في بحثنا على HSP. نشكر بول Luzio لإجراء مناقشات مفيدة. سلسلة pGBDU-C النواقل وPJ69-4A MAT على وMAT α سلالات الخميرة قدمت التفضل الدكتور فيليب جيمس (قسم الكيمياء الجزيئية البيولوجية، جامعة ويسكونسن في ماديسون، WI 53706-1532، الولايات المتحدة الأمريكية). وقد تم دعم هذا العمل من المنح المقدمة من مؤسسة ويلكوم ترست وبحوث العمل لER، وهو زميل السريرية يلكوم ترست المتقدم.

ملاحظات

  • † الكتاب أتمنى أن يكون معروفا أنه، ينبغي أن ينظر إلى الكتاب الأولين في رأيهم كما المؤلف الأول المشترك.
  • علم الوراثة الجزيئية البشرية، المجلد. 14، رقم (1) © جامعة أكسفورد 2005؛ جميع الحقوق محفوظة
المراجع

  • بار، ML و كيرنان، JA (1983) بالجهاز العصبي للانسان. هاربر والصف، فيلادلفيا، PA.
  • ريد، E. (2003) العلوم في الحركة: مواضيع المرضية الجزيئية مشتركة تظهر في paraplegias تشنجي وراثي. J. ميد. جينيه.، 40، 35 -39.
  • فينك، JK (2002) الشلل النصفي التشنجي وراثي. في Rimoin، DL، Pyeritz، RE، كونور، JM وKORF، BR (محرران) إيموري والمبادئ وRimoin وممارسة الطب الوراثي، EDN 4TH. هاركورت، لندن، المملكة المتحدة، 3124 -3145.
  • هاردينغ، AE (1984) وراثي الترنحات والاضطرابات ذات الصلة. تشرشل ليفينغستون، أدنبره.
  • حزان، J.، Fonknechten، N.، MAVEL، D.، Paternotte، C.، شمشون، D.، Artiguenave، F.، Davoine، CS، Cruaud، C.، Dürr ألف، A.، Wincker، P. وآخرون . (1999) Spastin، وهو بروتين AAA جديد، يتم تبديل في الشكل الأكثر شيوعا من راثي الشلل النصفي التشنجي المهيمن. نات. جينيه.، 23، 296 -303.
    CROSSREF ميدلاين ويب للعلوم
  • سوتر، S.، Miterski، B.، Klimpe، S.، Bonsch، D.، Schols، L.، Visbeck، A.، بابكي، T.، هوبف، HC، إنجل، W.، Deufel، T. وآخرون . (2002) تحليل الطفرة من الجين spastin (SPG4) في المرضى الذين يعانون في ألمانيا مع مرض وراثي جسمي الشلل النصفي التشنجي وراثي. همهمة. Mutat.، 20، 127 -132.
    CROSSREF ميدلاين ويب للعلوم
  • Charvin، D.، سيفوينتس-دياز، C.، Fonknechten، N.، جوشي، V.، حزان، J.، ملكي، J. وBetuing، S. (2003) الطفرات من SPG4 هي مسؤولة عن فقدان وظيفة spastin، وهو بروتين الخلايا العصبية وفيرة المحلية في النواة. همهمة. مول. جينيه.، 12، 71 -78.
    الملخص / الحرة النص الكامل
  • وارتون، SB، ماكديرموت، CJ، غريرسون، AJ، الخشب، JD، Gelsthorpe، C.، اينس، PG وشو، PJ (2003) وعلم الأمراض الخلوي والجزيئي للنظام المحرك في خزل سفلي تشنجي وراثي نتيجة لطفرة من spastin الجينات. J. Neuropathol. إكسب. Neurol.، 62، 1166 -1177.
    ميدلاين ويب للعلوم
  • Svenson، IK، اشلي، كوخ. AE، جاسكل، PC، Riney، TJ، كومينغ، WJ، كينغستون، HM، هوجان، EL، بستاني، RM، فانس، JM، نانس، MA آخرون (2001) تحديد والتعبير تحليل الطفرات الجينية spastin في راثية تشنجي الشلل النصفي. آم. J. هوم. جينيه.، 68،

رافت ابراهيم 11-22-2015 08:38 PM

Spastin وatlastin، اثنين من البروتينات المتحورة في راثي المهيمنة الشلل النصفي التشنجي وراثي، وشركاء ملزمة
 
http://hmg.oxfordjournals.org/content/15/2/307.full


ملخص

وparaplegias تشنجي وراثية نقية (شركائنا HSPs) هي مجموعة من الظروف التي يوجد فيها تقدمية تعتمد على طول انحطاط الغايات البعيدة للمحاور السبيل القشري، مما أدى إلى شلل تشنجي في الساقين. في معظم الأحيان يتم توريث شركائنا HSPs نقية في نمط وراثي جسمي وتسبب عادة من قبل الطفرات إما في spastin SPG4 الجينات أو في atlastin SPG3A الجينات. تحديد الشركاء ملزم للspastin، قمنا بإجراء الخميرة شاشة يومين الهجين على مكتبة [كدنا الدماغ، وذلك باستخدام spastin كطعم. بشكل ملحوظ، وكلها تقريبا من المتفاعل استنساخ فريسة إيجابية مشفرة لatlastin. لقد تحققنا من أهمية الفسيولوجية لهذا التفاعل باستخدام المشارك مناعي، الجلوتاثيون S -transferase المنسدلة والخلايا التجارب المشارك الترجمة. وتبين لنا أن المجال spastin اللازمة للربط إلى atlastin يكمن داخل N-80 محطة بقايا من البروتين، وهي المنطقة التي هي موجودة فقط في الغالب حشوية، كامل طول الإسوي spastin. وتشير هذه البيانات إلى أن spastin وظيفة atlastin في نفس مسار الكيمياء الحيوية، وأنها هي وظيفة حشوية من spastin وهو أمر مهم لإمراض HSP. كما أنها توفر المزيد من الأدلة على وجود دور الفسيولوجية والمرضية من spastin في ديناميات غشاء.
مقدمة

وparaplegias تشنجي وراثي (شركائنا HSPs) هي مجموعة متنوعة من الظروف العصبية مصممة وراثيا التي تشترك كل ميزة السريرية الرئيسية من الشلل التشنجي التدريجي في الأطراف السفلية. فإنها تصنف تقليديا كما نقية، أو عندما يترافق الشلل النصفي التشنجي بمظاهر سريرية أخرى بارزة، المعقدة (+1 - 3). ويعتبر النقي HSP عموما كنوع الأكثر شيوعا في شمال أوروبا وأمريكا الشمالية (4). في شركائنا HSPs نقية، والخلايا أهم إصابة هي الخلايا العصبية الحركية الجهاز القشري (غالبا ما تسمى "الخلايا العصبية الحركية العليا)، وتنعكس الصورة السريرية للشلل سفلي تشنجي التدريجي في النتائج المرضية التدريجي، طول التابعة، البعيدة 'dying- عودة 'انحطاط المحاور السبيل القشري (1). تحديد الجينات المسؤولة عن شركائنا HSPs وتوضيح وظيفة البروتينات المقابلة هو بداية لتوفير معلومات هامة في المسارات الجزيئية التي هي مهمة للحفاظ محور عصبي والحركية وظيفة الخلايا العصبية.
وقد تم تعيين ثمانية جسمية مهيمنة مواضع HSP نقية دراسات الربط الوراثية (إعادة النظر في 1،2،5). وقد تم إحراز تقدم سريع في تحديد جينات المرض في هذه المكاني، مع خمسة، atlastin (SPG3A)، spastin (SPG4)، NIPA1 (SPG6)، KIF5A (SPG10) وHSP60 (SPG13)، بعد أن تم عزلها حتى الآن (6 - 10). الطفرات في spastin وatlastin هي الأكثر شيوعا وتقدر لحساب 40 و 10٪ من الأسر HSP نقية جسمية مهيمنة على التوالي (5، 11 - 13).
وأعرب عن نص spastin على نطاق واسع داخل الجهاز العصبي والأنسجة في غير العصبية، ولكن يتم التعبير بشدة في الفئات الفرعية من الخلايا العصبية (7، 14، 15). وقد اقترحت الدراسات Immunolocalization في مجموعة متنوعة من الأنسجة وأنواع الخلايا عموما أن البروتين على حد سواء توزيع حشوية والنووي (+14 - 17). في الآونة الأخيرة، أصبح من الواضح أن هذا هو بسبب الفرق توطين اثنين إيسفورمس الرئيسية للبروتين: شكل اقتطاع N-المحطة الطرفية النووي وحشوية، في حين يتم تصدير شكل كامل طول أقل وفرة بنشاط من النواة إلى السيتوبلازم ( 18). وقد وصفت توزيع حشوية كما منقط ومحيط بالنواة في دراسة واحدة (16)، في حين أنه في آخر، تم العثور spastin في المناطق الخلوية هيولية تحتوي على الأنابيب الدقيقة الحيوية، والتي تضمنت في خط الخلية العصبية محور عصبي القاصي ونقاط فرع محور عصبي (17). في الأنسجة العصبية البشرية، يقع spastin في السيتوبلازم ومتشابك محطات عدة أنواع الخلايا العصبية، بما في ذلك الخلايا العصبية الحركية، وإن كان في غيرها من أنواع الخلايا العصبية، تم الكشف عن ذلك في النواة (15).
وفيما يتعلق ظيفة حشوية من spastin، الرئيسيتين، وربما ذات الصلة، وقد اقترحت الأدوار الخلوية. Spastin هو AAA أتباز ترتبط ارتباطا وثيقا في تسلسل لP60 katanin، وهو أنيبيب قطع البروتين، ومجموعة متنوعة من البيانات تشير إلى أن spastin من المرجح أن يكون لها دور في الأنابيب الدقيقة قطع (19، 20). في الخلايا المستزرعة معربا عن الموسومة حاتمة spastin، ارتبط التعبير عن بروتين مع ظهور حزم أنيبيب كسر في غضون السيتوبلازم. في هذه التجارب، والبروتين المترجمة إلى منقط منفصلة الهياكل حشوية لا تقابل العضيات معروفة، ولكن تذكر من تلطيخ منقط ينظر في بعض الدراسات الأجسام المضادة لبروتين الذاتية (19). وعلاوة على ذلك، أدى التعبير عن تحور-أتباز خلل spastin في ضرب خيوط حشوية التي تحتوي على واحدة الأنابيب الدقيقة (19، 21). هذه النتائج متوافقة مع توطين spastin الذاتية للمناطق حشوية الغنية في الأنابيب الدقيقة الحيوية. بيانات من نماذج ذبابة الفاكهة أيضا دعم وجود علاقة بين ذبابة الفاكهة spastin (D spastin) ومنظمة أنيبيب في الخلايا العصبية والأنسجة الأخرى (22، 23، 24).
وبصرف النظر عن دوره في تنظيم أنيبيب، كما أشير إلى أن spastin قد يكون متورطا في أحداث المرور غشاء الخلايا. وقدم هذا الاقتراح لأول مرة عندما كان من المسلم به أن spastin له أنيبيب N-محطة التفاعل والاتجار (MIT) المجال (25، 26). معظم، إن لم يكن كلها، والبروتينات الأخرى التي تحتوي على هذا النطاق لها أدوار في حركة الغشاء (26). وقد عززت الأدلة على تورط spastin في أحداث المرور غشاء مؤخرا تعريفنا لمنطقة CHMP1B البروتين endosomal كشريك ملزم للspastin (27). CHMP1B يموضع إلى الإندوسومات ويرتبط مع ESCRT-III (endosomal الفرز المعقدة اللازمة لنقل-III)، وهو بروتين معقد الذي يعمل في فرز بروتينات ubiquinated أحادية للجسم عديد الحويصلات، حجرة التقامي prelysosomal (إعادة النظر في 27). حددت هذه الدراسة أيضا بروتين الغشاء جولجي، gp25L2، كشريك محتمل ملزم لspastin، على الرغم من عدم يتميز هذا التفاعل تماما حتى الآن (27). كما ترتبط العديد من الفعاليات المرورية غشاء بالنقل القائم على أنيبيب، فمن غير المستبعد أن حركة الغشاء والأدوار التي تنظم أنيبيب من spastin قد تكون بين ذات الصلة.
يتكون هذا الجين atlastin من 14 الإكسونات، الذي رمز لبروتينا 558 الأحماض الأمينية طويلة (6). يتم التعبير عن الجينات في العديد من أنسجة الجسم، مع أعلى التعبير في الدماغ والحبل الشوكي (6). مع استثناءات نادرة، والطفرات في بداية مرحلة الطفولة atlastin سبب HSP. وكانت معظم الطفرات atlastin نشرت حتى الآن الطفرات مغلطة، مع طفرة انزياح الإطار وصفه (28 - 34).
البروتين atlastin هو GTPase رواية مشابهة لأفراد الأسرة dynamin من GTPases كبيرة (6). فقد اثنين من المجالات عبر الغشاء المفترضة مع طوبولوجيا غشاء مما أدى إلى N- وC-تيرميني التعرض إلى السيتوبلازم (35). الموقع GTPase نشطة وتتشكل من بقايا في ثلاثة أفكار، وP-حلقة، DxxG وRD الزخارف. قد oligomerize البروتين لتشكيل homotetramers (35).
وقد تمت دراسة توزيع الخلوي للatlastin في أقسام الدماغ الفئران (35). هنا، كانت خلايا إيجابية atlastin الأكثر وفرة في الصفيحة V من القشرة الدماغية، مع كل من سوما الخلايا العصبية وشجيري شجرة تحتوي على atlastin. على المستوى التحت خلوية في الفئران مثقف الخلايا العصبية تحت القشرية، وatlastin تقع في الغالب في جهاز رابطة الدول المستقلة -Golgi، مع منقط تلطيخ ينظر أيضا في المحاور والتشعبات. واعتبر بعض محدود شارك في التعريب مع الشبكة الإندوبلازمية (ER) علامات أيضا (35). يبقى دور وظيفي دقيق لatlastin في غشاء جولجي أو في غيرها من مواقع عضية الغشاء إلى توضيح.
في هذه الدراسة، شرعنا في اكتساب رؤى إضافية إلى وظيفة spastin، من خلال تحديد الشركاء ملزم جديد للبروتين. وجهت لنا السابقة الخميرة spastin شاشة يومين الهجين ضد مكتبة erythroleukaemia كدنا] (27). من أجل تحديد الشركاء ملزم التي قد تكون مهمة لوظيفة spastin في النظام العصبي المركزي، كررنا الخميرة شاشة يومين الهجين باستخدام مكتبة [كدنا مخ الجنين. بشكل ملحوظ، الواردة عن ما يقرب من الحيوانات المستنسخة التفاعل الإيجابي كدنا] atlastin، مما يشير بقوة إلى أن هذين البروتينات HSP تتفاعل مع بعضها البعض. لقد أكد هذا التفاعل المحتملين من خلال التجارب المشتركة مناعي وسحب إلى أسفل، جنبا إلى جنب مع دراسات شارك في توطين باستخدام الموسومة حاتمة من النوع البري والبروتينات متحولة في خطوط الخلايا العصبية وغير العصبية. معا، وتوفر هذه البيانات والأدلة التجريبية الأولى التي اثنين من البروتينات المشاركة في HSP التفاعل بأنفسهم. أنها توحي بأن spastin وatlastin المشاركة في نفس مسار الكيمياء الحيوية وعلم الأمراض الجزيئي أن من spastin وatlastin HSP هو ذات الصلة. كما أنها توفر دليلا إضافيا على أن spastin تشارك في أحداث المرور الغشاء.

النتائج

الخميرة اثنين الهجين، الجلوتاثيون S -transferase (GST) المنسدلة وشارك في مناعي التجارب تحدد atlastin كشريك ملزم من spastin

استخدمنا كامل طول spastin البروتين ك "الطعم" لفحص الخميرة الإنسان يومين الهجينة مكتبة كدنا] دماغ الجنين عالية التعقيد (Clontech)، وذلك باستخدام الأساليب المذكورة سابقا (27). هذه الشاشة ولدت 15 استنساخ مضاعفا الإيجابية التي نمت على انتقائية وسائل الإعلام التي تفتقر إلى الأدينين وكانت ايجابية للنشاط β غالاكتوزيداز. عندما تم اختبار هذه التفاعلات الأساسية في الخميرة الطازجة، تم العثور على ثمانية على حد سواء استنساخه والطعم محددة، مع إعطاء قوي النشاط β غالاكتوزيداز والنمو القوي في المتوسط ​​انتقائية تفتقر التربتوفان، ليسين والأدينين (-W / L / A). بشكل ملحوظ، ولكن كل اثنين من الإيجابية "فريسة" استنساخ الواردة atlastin تسلسل الترميز.
من أجل التحقق من مدى أهمية التفاعل المفترض بين spastin وatlastin، قمنا أولا من التجارب GST المنسدلة. انسحب GST-spastin بنجاح أسفل atlastin من المحللة من خلايا عابر مع ناقلات التعبير الثدييات يحتوي ج. Myc على الموسومة atlastinΔTM (MYC-atlastinΔTM؛ الشكل 1)، مشيرا إلى أن اثنين من البروتينات قادرة على التفاعل الكيميائي (الشكل. 2 A). نحن تتميز بجانب المجالات البروتين spastin اللازمة للتفاعل مع atlastin، باستخدام الخميرة اثنين الهجين وGST التجارب المنسدلة. اختبرنا atlastin ناقلات فريسة ضد الخميرة ناقلات الطعم يومين الهجينة التي تحتوي على إدراج الترميز لعدة أشكال اقتطاع من spastin، spastinΔAAA، spastinΔN1 وspastinΔN2 (الشكل 1). وجدنا أن الخميرة واستمر التفاعل هجين اثنين مع spastinΔAAA الطعم متجه، لكنه خسر عندما استخدمت spastinΔN1 وspastinΔN2 الطعوم (الشكل 2 B). المقايسات أسفل سحب باستخدام GST-atlastinΔTM ولست] خلية من الخلايا المصابة بالعدوى بالنقل مع أشكال متحولة من spastin كانت أيضا بما يتفق مع هذه النتائج؛ كان GST-atlastinΔTM قادرة على هدم MYC-spastinΔAAA وMYC-spastinK388R (شكل من أشكال spastin تحتوي على طفرة مغلطة الأمراض المرتبطة)، ولكن ليس MYC-spastinΔN1 أو spastinΔN2-GFP، من لست] من الخلايا المصابة بالعدوى بالنقل مع بناء ذات الصلة (الشكل . 2 C). وتشير هذه البيانات إلى أن منطقة spastin المسؤولة عن التفاعل مع atlastin تكمن في N-محطة من البروتين، من بقايا 1-80. وقد أظهرت البيانات الأخيرة أن spastin فقد اثنين من مواقع الترجمة بدء، الأولى في كودون 1 والثانية في كودون 87، مما أدى إلى إنتاج اثنين إيسفورمس spastin الرئيسية، نادر، في الغالب حشوية، شكل كامل طول (~68 كيلو دالتون حجم) وأكثر وفرة أقصر، الإسوي النووي وحشوية (~60 كيلو دالتون) (18). الوضع تعقيدا بسبب وجود أحداث الربط بديلة، مما يؤدي إلى وجود إصدارات اكسون طفيفة 4 حذف للإيسفورمس طويلة وقصيرة (في ~64 و 55 كيلو دالتون، على التوالي). لذا بيانات التفاعل لنا المجال تشير إلى أن فقط طويلة (أي 68 و 64 كيلو دالتون) إصدارات الإسوي من spastin قادرة على التفاعل مع atlastin.
http://hmg.oxfordjournals.org/conten...7/F1.small.gif
الشكل 1. التركيبات المستخدمة في هذه الدراسة. رسم تخطيطي يظهر بنية المجال البرية من نوع (WT) spastin وatlastin، جنبا إلى جنب مع هيكل إدراج الأخرى المستخدمة في التركيبات. وتعطى الترقيم الأحماض الأمينية فوق كل بناء، في حين يتم عرض موقف طفرة نقطة K388R التي شملتها الدراسة في الخط الرمادي فوق التوضيح spastin WT. HR، المنطقة مسعور. AAA، AAA أتباز كاسيت. GTPase، GTPase كاسيت. TM، مجال الغشاء.

http://hmg.oxfordjournals.org/conten...7/F2.small.gif
الشكل 2. Spastin وatlastin تتفاعل كيميائيا.
> كان يستخدم (A) GST-spastin في تجربة المنسدلة باستخدام المحللة خلية من خلايا هيلا مع transfected MYC-atlastinΔTM. واعتبر فرقة من الحجم الصحيح لMYC-atlastinΔTM في حارة المنسدلة (حارة 4)، ولكن ليس في الممرات من التجارب التي تفتقر إلى البروتين GST (حارة 1)، والتجارب باستخدام فارغة ضريبة السلع والخدمات بدلا من GST-spastin (حارة 2 )، أو التجارب التي تم فيها إضافة أي المحللة خلية (حارة 3). ونفذت (B) التحقيق في المجالات spastin المسؤولة عن التفاعل مع atlastin خارج باستخدام الخميرة اثنين الهجين. يظهر سيطرة العمود 1 نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان ويسين (-W / L) لتحديد وجود كل من الطعم وناقلات فريسة. ويبين العمود 2 نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان، ليسين والأدينين (-W / A / L)، الأمر الذي يتطلب تفعيل مراسل الجين أدي، في حين أن العمود السيطرة 3 يظهر نمو المستعمرات مضاعفا على وسائل الإعلام التي تفتقر التربتوفان، يسين والحامض الاميني (-W / H / L)، الأمر الذي يتطلب تفعيل صاحب مراسل الجينات. في كل حالة، تم استخدام spastin أو متحولة spastin كما البروتين "الطعم"، في حين كان يستخدم atlastin باسم 'فريسة'. كامل طول spastin وspastinΔAAA التفاعل مع atlastin، ولكن spastinΔN1 وspastinΔN2 لا. لم يكن التفاعل الحالي مع فريسة غير محددة (LSM2). تجارب (C) GST المنسدلة باستخدام GST-atlastinΔTM مقابل لست] خلية من الخلايا المصابة بالعدوى بالنقل مع ذكر يبني أكدت الخميرة النتيجتين الهجينة. كان البروتين GST الانصهار قادرة على هدم MYC-spastinΔAAA وMYC-spastinK388R، ولكن ليس MYC-spastinΔN1 أو spastinΔN2-GFP. (D) المشارك مناعي من عابر. MYC-spastin وatlastin-GFP في الخلايا HEK293T. بعد أربع وعشرين ساعة ترنسفكأيشن، وimmunoprecipitated البروتينات الموسومة (IP) باستخدام الأجسام المضادة بولكلونل مكافحة GFP وimmunoblotted (IB) مع الأجسام المضادة وحيدة النسيلة المضادة للMYC. وكانت فرقة من الحجم المتوقع لtransfected كامل طول MYC-spastin شارك في immunoprecipitated مع atlastin-GFP. كان لا الفرقة الحالية عندما تم حذف الأجسام المضادة لمكافحة GFP من رد فعل مناعي. (E) محاولة المشارك مناعي من عابر. MYC-spastin وناقلات فقط EGFP كعنصر تحكم السلبية لل(D). لم يشارك immunoprecipitated-MYC-spastin مع GFP. لقطع (D) و (E)، وتبين الممرات إدخال ألفا-MYC وα-GFP immunoblots الكسور المدخلات، مؤكدا التعبير من البروتينات ذات الصلة في الخلية لست] تستخدم لimmunoprecipitations. (F) spastin الذاتية وatlastin موجودة في الخلايا NSC34. تم تحديد Spastin باستخدام الأجسام المضادة spastin S51. هذه الأجسام المضادة يكشف عن ثلاث فرق في هذا صمة عار، الموافق إيسفورمس مختلفة من spastin كامل طول (68 كيلو دالتون، السهم إلى اليمين من الممر موقف علامات)، شكل قصيرة (60 كيلو دالتون) والبديل النموذج القصير تفتقر اكسون 4 (55 كيلو دالتون). اكسون كامل طول الإسوي تفتقر 4 (64 كيلو دالتون) هو من هذا القبيل وفرة المنخفضة التي لا ينظر إليها على هذا وصمة عار. باستخدام 5409 الأجسام المضادة لمكافحة atlastin، شوهدت فرقة واحدة من ~55 كيلو دالتون. (G) في ظل ظروف تغيير طبيعة، وimmunoprecipitated atlastin بقوة من خلايا NSC34 من قبل الضد 5409 atlastin. يظهر الممر الأيسر والمحللة خلية الإدخال، بينما يظهر في الممر الأيمن لimmunoprecipitate. وقد نشف على حد سواء مع الأجسام المضادة atlastin. (H) atlastin الذاتية وMYC-spastin وشارك في immunoprecipitated من خلايا NSC34. كان يستخدم لمكافحة atlastin 5409 أجسام مضادة لimmunoprecipitate في ظل ظروف تغيير طبيعة وأجريت immunoblotting استخدام الألغام المضادة MYC. فرقة من حجم المتوقع لMYC-spastin موجودة في المحللة المدخلات وفي immunoprecipitate. وكانت هذه الفرقة غائبة عندما تم استخدام الأجسام المضادة السيطرة زائف (مكافحة GFP) لتنفيذ مناعي. العلامات النجمية علامة على موقف المناعي كانت أيضا موجودة عندما تم حذف الأجسام المضادة لمكافحة MYC الأساسي من إجراء immunoblotting (لا تظهر البيانات) العصابات هذه. يتم عرض موقف العصابات علامة ذات الصلة إلى اليسار من كل وصمة عار.

حاولنا المقبل للتحقق من ملاءمة الفسيولوجية للتفاعل spastin atlastin من خلال التجارب المشتركة مناعي. شاركنا immunoprecipited-حاتمة الموسومة MYC spastin وatlastin-GFP، معربا عن عابر هذه البروتينات في الخلايا HEK293T وimmunoprecipitating مع مكافحة GFP الأضداد. immunobloting اللاحقة من الراسب مع مكافحة MYC كشفت عن وجود عصابة من حجم المتوقع ل-MYC spastin (~68 كيلو دالتون؛ الشكل 2 D). وكانت هذه الفرقة لم تكن موجودة عندما تم حذف الأضداد GFP من رد فعل مناعي أو عندما تم تنفيذ مناعي من استخدام الخلايا transfected المشترك مع-MYC spastin وناقلات GFP فارغة (الشكل 2 E).
وأخيرا، حاولنا إجراء التجارب المشتركة مناعي باستخدام الأجسام المضادة لspastin الذاتية وatlastin. كنا اثنين من الأجسام المضادة التي نشرت في هذه التجارب. كان أول S51، الأرنب بولكلونل الأجسام المضادة لمكافحة spastin (هدية كريمة من ايلينا Rugarli) (17). هذه الأجسام المضادة يمكن الكشف عن إيسفورمس spastin الرئيسية في الخلية لست] NSC34 (الشكل 2 F)، وقادر على immunoprecipitating spastin. كان الضد الثاني الأرنب بولكلونل مكافحة atlastin الأجسام المضادة (5409 وهدية عينية من كريغ بلاكستون) (35). هذه الأجسام المضادة يكشف عصابة قوية واحدة تقريبا في حجم توقع لatlastin (ج 55 كيلو دالتون) على النشاف الغربي من NSC34 المحللة خلية (الشكل 2 F). على مناعي خلايا NSC34 في ظل ظروف غير تغيير طبيعة استخدام إما spastin S51 الأجسام المضادة أو الأجسام المضادة atlastin، كنا قادرين على إثبات أي شريك مناعي الشريك ملزم المفترض الذاتية. كما كنا بالقلق من أن مناعي من atlastin من الأجسام المضادة atlastin كان ضعيفا في ظل ظروف غير تغيير طبيعة، ونحن التحقيق في قدرة هذه الأجسام المضادة إلى immunoprecipitate atlastin من خلايا NSC34 في ظل ظروف تغيير طبيعة وجدت مناعي قوي (الشكل 2 G). لذا أجرينا التجارب المشتركة مناعي في ظل ظروف تغيير طبيعة، علاج الخلايا مع dithiobis الكيميائية عبر رابط [succinnimidyl بروبيونات] (DSP) قبل تحلل، من أجل الحفاظ على تفاعلات البروتين البروتين. ومع ذلك، كنا لا نزال غير قادرين على إثبات أي شريك مناعي من spastin الذاتية (لا تظهر البيانات).
نحن افترضنا أن السبب في أننا لم يستطع إثبات أي تفاعل بين البروتينات الذاتية كان بسبب وفرة منخفضة جدا من كامل طول 68 كيلو دالتون spastin (الشكل 2 F)، وشكل قادر على التفاعل مع atlastin. في ضوء ذلك، بحثنا ما إذا كان توفير إضافي كامل طول spastin خارجية المنشأ قد يسمح لنا لإظهار المشترك مناعي مع atlastin الذاتية ووجدنا أن هذا هو الواقع بالفعل. عندما كنا الأجسام المضادة atlastin تحت تغيير طبيعة الظروف لimmunoprecipitate atlastin من خلايا NSC34 معربا عن MYC-spastin، وجدنا أن MYC-spastin كان المشارك immunoprecipitated (الشكل 2 H). لم MYC-spastin المشارك immunoprecipitated عندما تم استخدام الأجسام المضادة immunoprecipitating زائفة (الشكل 2 H).
وباختصار، كنا قادرين على التعرف على التفاعل بين spastin وatlastin بواسطة الخميرة اثنين الهجين، GST المنسدلة والتجارب المشتركة مناعي. وتوفر هذه النتائج دليلا قويا جدا أن spastin وatlastin قادرة على الربط مع بعضها البعض وأن هذا التفاعل له أهمية فسيولوجية.

atlastin الموسومة حاتمة وspastin شارك في توطين في خلايا هيلا وNSC34

وبعد إثبات وجود تفاعل بين spastin وatlastin، وذهبنا بعد ذلك إلى تحديد ما إذا كان هناك أي توطين المشترك بين البروتينات في خلايا الثدييات، وإذا كان الأمر كذلك حيث كان الموقع للتفاعل، عن طريق فحص التوزيع داخل الخلايا حاتمة البروتينات -tagged.
قبل فحص ما إذا كان spastin وatlastin أظهرت الخلايا شارك في الترجمة، وأنشأنا توزيع الخلايا في خلايا الثدييات من الإصدارات الموسومة حاتمة من atlastin، وهذا لم يسبق وصفه. لتقليل احتمالات التغيرات التي يسببها العلامة في التوزيع، التي قطعناها على أنفسنا بنيات معربا إما N-محطة ج-Myc- أو الإصدارات الموسومة GFP C-محطة من كامل طول atlastin ودرست نمط التعبير عن كل بناء المناعي باستخدام متحد البؤر مجهر. في كل حال، يبدو الموسومة حاتمة atlastin في نمط شبكي في جميع أنحاء سيتوبلازم خلايا هيلا عابر.. هذا النمط تلطيخ شبكي بقوة شارك المترجمة مع calreticulin، علامة من ER (الشكل 3 A-F)، ومع الأجسام المضادة لاثنين من البروتينات ER أخرى، PDI (بروتين ثاني كبريتيد مزامرة)، وهو بروتين lumenal، وsec61α، وهو ER بروتين الغشاء (لا تظهر البيانات). في ضوء التفاعل بين spastin وatlastin، والعلاقة بين spastin والأنابيب الدقيقة، درسنا أيضا ما إذا كان atlastin شارك المترجمة مع تويولين. وجدنا جزئي شارك في التعريب بين atlastin الموسومة حاتمة والأجسام المضادة لمكافحة تويولين YL1 / 2 (الشكل 3 G-I)، رغم عدم وجود تأثير الإجمالي لatlastin التعبير على العمارة أنيبيب. هذا التعريب المشترك بين atlastin والأنابيب الدقيقة وربما ليس من المستغرب، كما هو معروف في ER أن يكون لها ارتباط وثيق مع الإطار أنيبيب. اختبرنا أيضا لاشتراكهما في التعريب بين atlastin الموسومة حاتمة وبطارية من علامات الأضداد الأخرى، والتي شملت EEA1 (لالإندوسومات المبكر)، M6PR (لالإندوسومات المتأخرة وشبكة -Golgi غير المشبعة)، Lamp1 (لالجسيمات الحالة)، GM130 (ل جهاز جولجي) وTGN46 (لشبكة -Golgi غير المشبعة). وجدنا بعض محدود شارك في التعريب بين atlastin-GFP وM6PR (الشكل 3 J-L) وGM130 (الشكل 3 M-O)، على الرغم من أننا لا يمكن أن يكون متأكدا ما إذا كان هذا قد يعكس ببساطة حقيقة أن العضيات هذه العلامات كشف وتقع على مقربة من مركز أنيبيب المنظمة، حيث التعبير عن علامات ER هي أيضا قوية جدا.
http://hmg.oxfordjournals.org/conten...7/F3.small.gif
الشكل 3. حاتمة الموسومة النوع البري ومتحولة atlastin شارك في توطين مع ER وأنيبيب علامات. الصور تظهر خلايا هيلا المسمى مع علامة الضد هو مبين في (A، D، M). (B، E،K، N) إظهار نمط التعبير في نفس الخلايا، عابر. مع بناء يظهر في كل لوحة. لون النص في كل من هذه اللوحات يمثل لون الصورة في المقابلة وحات المدمجة (C، F،L، O). كلا N-محطة-MYC الموسومة (A-C) والموسومة GFP C-محطة (D-F) atlastin شارك في توطين بإحكام مع calreticulin. من النوع البري atlastin أيضا جزئيا شارك يموضع مع علامة أنيبيب YL1 / 2 (G-I). كان هذا التعريب شارك الأقوى في المنطقة محيط بالنواة. وهناك أيضا الجزئي شارك في التعريب مع الراحل endosomal المانوز-6-فوسفات مستقبلات (M6PR) (J-L) وGM130 جولجي علامة (M-O)، لا سيما في منطقة محيط بالنواة التنسيق حيث أظهر atlastin تعبير قوي. الخلايا كانت ثابتة 24 ساعة بعد ترنسفكأيشن. الحانات حجم تشير إلى 10 ميكرون.

بالإضافة إلى التجارب في خلايا هيلا، درسنا نمط التعبير عن الموسومة حاتمة atlastin في ماوس المحرك نوع من الخلايا العصبية، NSC34. ويستمد هذا نوع من الخلايا الهجين من الانصهار بين الفأر الشوكي الخلايا العصبية الحركية الحبل وخط الخلية العصبية والعديد من التشريحية، الدوائية والكهربائية خصائص الخلايا العصبية (36). لج. Myc على وatlastin -GFP الموسومة، وكان نمط التعبير في الخلايا NSC34 مشابهة جدا لتلك التي المقابل البروتين في خلايا هيلا. كان Atlastin التعبير موجودة في كل خلايا الجسم وملحقات محوار (لا تظهر البيانات).
بعد أن أنشأ التوزيع داخل الخلايا الموسومة حاتمة atlastin، درسنا شارك في توطين spastin الموسومة حاتمة وatlastin في خلايا هيلا (الشكل 4 A-G) وNSC34 الخلايا (الشكل 4 H-J). وجدنا جزئي لكنه واضح شارك في التعريب بين spastin وatlastin البروتينات وهذا لا يعتمد على طبيعة أو موقع العلامة حاتمة المستخدمة. كان في توطين شارك في خلايا هيلا عادة في نقاط وحشوية / الأنابيب الصغيرة، والتي أيضا شارك المترجمة مع calreticulin ER علامة (الشكل 4 A-G). في الخلايا NSC34، وقع شارك في التعريب في سوما وneurites التي (الشكل 4 H-J).
http://hmg.oxfordjournals.org/conten...7/F4.small.gif
الرقم 4. حاتمة الموسومة atlastin وspastin شارك في توطين في خلايا هيلا وNSC34. خلايا هيلا (A - G و K - W) أو خلايا NSC34 (H - J) كانت المشترك مع transfected MYC-spastin وatlastin-GFP (A-J)،-MYC spastin وحدها (K-M)، MYC-spastinK388R وatlastin-GFP (N-Q)، MYC-spastinK388R وحدها (R-T) أو MYC spastin وGFP-VPS4-EQ (U-W). وصفت الخلايا هو مبين في (D-G) و (K-T) أيضا مع ER علامة المضادة للcalreticulin (F، L، P، S). (C، G، J، M، Q، T، W) تظهر الصور المدمجة من الخلايا هو موضح في (A و B)، (D-F)، (H وI)، (K و L)، (N ف)، (R و S) و (U و V)، على التوالي، مع لون النص في كل لوحة تشير إلى صورة ملونة في الصورة المدمجة. في كل من الخلايا هو موضح في (A-J)، هناك محدد شارك في التعريب بين spastin وatlastin البروتينات. كل من البروتينات المترجمة المشترك (D-G) وMYC spastin أعرب وحدها (K-M) كما شارك في توطين مع calreticulin. في الخلايا NSC34 (H-J)، واعتبر المشارك التعريب في كل من سوما ومحوار ملحقات. في الخلايا معربا عن spastin متحولة والبرية من نوع atlastin (N-Q)، وإعادة توزيع atlastin وcalreticulin للمشاركة في توطين مع spastin متحولة في خيوط. خارجي التعبير atlastin ليس من الضروري لcalreticulin ليتم إعادة توزيعها بهذه الطريقة (R-T). وكانت نسبة من-MYC spastin التعبير أيضا على الإندوسومات، كما شارك جزئيا المترجمة مع GFP-VPS4-EQ (U-W، السهام). الخلايا كانت ثابتة 24 ساعة بعد ترنسفكأيشن. الحانات حجم تشير إلى 10 ميكرون.

كما الموسومة حاتمة spastin شارك المترجمة مع atlastin على ER، نحن مصممون المقبل ما إذا كانت بعض spastin الموسومة حاتمة غير موجودة على ER في غياب atlastin خارجي أو ما إذا كان التعبير عن atlastin تسبب في إعادة توزيع spastin إلى ER. وجدنا كبير شارك في التعريب في نقاط ووالأنابيب من مجموعة فرعية من بين MYC spastin مع calreticulin (الشكل 4 K-M)، ولكن هذا لم يكن قويا كما كان توطين ER عندما كان MYC-spastin المشارك أعرب مع atlastin-GFP (الشكل 4 D-G)، مما يشير إلى أن شاركت في التعبير مع atlastin تسبب توظيف spastin لER، ربما لأن مواقع الربط إضافية قدمت هناك من atlastin التعبير. عندما أبديت-GFP spastin وspastin-GFP وحده، وكان شارك في التعريب مع calreticulin الحالي، ولكن ذاتي محدود أكثر من ذلك مع MYC-spastin أيضا.
درسنا القادم ما إذا كانت atlastin شارك المترجمة مع أشكال أتباز معيبة من spastin. درسنا آثار atlastin التعبير على طفرة spastin المسببة للأمراض، K338R. طفرة K388R spastin تلغي وظيفة أتباز ويرتبط مع وضع غير طبيعي، والنمط الظاهري الخيطية عندما أعرب في الخلايا المستزرعة. شعيرات طبيعية جزئيا شارك توطين مع علامات الأنابيب الدقيقة (19، 27). وجدنا أن متحولة spastin الاحتفاظ مظهر الخيطية عندما تم تغيير مع الموسومة حاتمة atlastin وأن توزيع atlastin-أعرب شارك بشكل كبير بحيث أظهر بروتين قوي شارك في التعريب مع خيوط غير طبيعية (الشكل 4 N-Q). في الخلايا NSC34، وخيوط غير طبيعية امتدت إلى عمليات محوار، وكان ينظر قوي شارك في توطين هنا، وكذلك في سوما (لا تظهر البيانات). ورافق إعادة توزيع atlastin بواسطة إعادة توزيع calreticulin، والتي أيضا شارك المترجمة مع خيوط spastin متحولة (الشكل 4 P). واعتبرت إعادة توزيع مماثل للER عندما أعرب عن MYC-spastinK388R في خلايا هيلا في غياب atlastin الخارجية (الشكل 4 R-T).
وقد اقترحنا في وقت سابق ان بعض التعبير spastin قد يكون على الإندوسومات، على أساس البيانات التي تظهر التفاعل بين spastin وCHMP1B البروتين endosomal. وصفناها أيضا colocalization بين-MYC spastin وGFP الموسومة علامة endosomal RhoB (27). ومع ذلك، استخدمت تجاربنا السابقة شارك في توطين وRhoB بناء الموسومة GFP (Clontech) التي كانت غير لائقة، حيث أنه يشتمل على حاتمة ج. Myc على. وبالتالي فإننا إعادة التحقيق توطين endosomal من spastin أعرب عابر من خلال فحص خلايا هيلا التعاون مع transfected-MYC spastin وN-محطة-GFP الموسومة الثدييات VPS4-E235Q (هدية عينية من بول وايتلي) (37). البروتين GFP-VPS4-E235Q-أتباز خلل يتراكم على الإندوسومات تورم، التي تحتفظ مكونات المجمع ESCRT-III على الأغشية الحد منها (37). وجدنا كبير جزئي شارك في التعريب بين MYC-spastin وGFP-VPS4-E235Q، مما يشير بقوة إلى أن جزء من السكان من spastin موجود على الأغشية endosomal (الشكل 4 U-W). ولذلك يبدو من المرجح أن spastin يمكن أن تكون موجودة على اثنين على الأقل من سكان الغشاء، الإندوسومات وER.
من أجل الحصول على مزيد من المعلومات حول تكوين شعيرات المرتبطة أتباز معيب spastin، ونحن التحقيق على الصعيد التركيبية. نحن عابر شارك transfected خلايا هيلا مع MYC-spastinK388R وatlastin-GFP وفحص الخلايا تحت المجهر الالكتروني. وجدنا حزم من الأنابيب الدقيقة في سيتوبلازم خلايا transfected المشترك (الشكل 5 A). كان الأنابيب الدقيقة الفردية ضمن هذه الباقات مظهر غير طبيعي، وجود التصدعات الإلكترون الكثيفة.ورأينا أيضا هياكل حشوية مع مثل العسل مظهر غير طبيعي في هذه الخلايا (الشكل 5 B) وكانت هذه الهياكل المستمر في بعض الأحيان مع ER (الشكل 5 B) أو الغلاف النووي (الشكل 5 C). في بعض المقاطع، كانت الهياكل العسل متجاورة مع حزم أنيبيب غير طبيعية (الشكل 5 D).
http://hmg.oxfordjournals.org/conten...7/F5.small.gif
الرقم 5. فإن التركيب الدقيق للخيوط المرتبطة أتباز معيب
spastin.> وعلى الصعيد المجهر الالكتروني، وخلايا transfected المشترك مع MYC-spastinK388R وكان atlastin-GFP حزم غير طبيعية من الأنابيب الدقيقة في السيتوبلازم (A). كانت الأنابيب الدقيقة إلكترون طلاء كثيفة غير عادية. وشوهدت أيضا هياكل العسل كثيفة، وفي بعض الأماكن، وكانت هذه المستمر مع ER (B، رأس السهم) أو مع الغشاء النووي (C، السهام). في بعض الحالات، كانت متجاورة مع حزم أنيبيب غير طبيعية (D، السهم). تظهر جميع لوحات خلايا هيلا التي تم إصلاحها 24 ساعة بعد ترنسفكأيشن. ويمثل حجم شريط 200 نانومتر. جميع الصور هي في نفس التكبير.

نقاش

في هذه الدراسة، كنا الخميرة نهج هجين اثنين لتحديد الشركاء المحتملين لالمتفاعل spastin، وهو بروتين تحور في جسمية مهيمنة النقي HSP. بشكل ملحوظ، حدد هذا النهج atlastin، بروتين آخر تحور في جسمية مهيمنة النقي HSP، كشريك ملزم spastin المحتملين. نحن التحقق من أهمية هذا التفاعل في خلايا الثدييات من قبل مجموعة متنوعة من الأساليب، والتي توفر معا أدلة دامغة على أن spastin وatlastin شركاء ملزم صحيح. هذا التفاعل هو اول دليل على وجود علاقة وظيفية مباشرة بين اثنين من البروتينات المشاركة في HSP. وجودها تشير بقوة إلى أن spastin وatlastin المشاركة في نفس مسار الكيمياء الحيوية وعلم الأمراض الجزيئي أن من spastin وatlastin HSP مرتبط.
ومن المسائل التي كانت دراستنا غير قادرة على معالجة قاطع الموقع التحت خلوية من التفاعل spastin atlastin. لدينا البيانات مع البروتينات الموسومة حاتمة تشير إلى أن تتفاعل على ER، كما وجدنا أن atlastin الموسومة حاتمة بقوة شارك المترجمة مع علامات ER (وإلى حد أقل مع جهاز جولجي)، أن-حاتمة الموسومة كامل طول spastin أظهر جزئي، ولكن واضح، وشارك في التعريب مع calreticulin ER علامة وأنه عندما شارك أعرب، الموسومة حاتمة كامل طول spastin وatlastin شارك المترجمة مع بعضها البعض ومع calreticulin. فمن الممكن أن مجموعة فرعية من spastin الذاتية قد يكون موجودا على لائحة أو الدراسات immunolocalization شبكة السابقة أنيبيب متجاورة لم فحص على وجه التحديد ما إذا كانت نسبة من التعبير حشوية من spastin قد تكون في أو قريبة جدا من ER. على الرغم من أن الدراسة immunolocalization السابقة وجدت بعض atlastin الذاتية على ER، الموقع الرئيسي للبروتين الذاتية على جهاز جولجي، وهو الموقع الذي كان أقل وضوحا مع الموسومة حاتمة atlastin (35). ويمكن أن تشمل تفسيرات لهذا التفاوت والمناعي عبر رد فعل من الأجسام المضادة atlastin مع بروتين آخر، فإن وجود ER وجولجي أشكال atlastin مع حساسية مختلفة / الحواتم المتاحة لالأجسام المضادة أو آثار العلامة حاتمة على توطين البروتين. ومع ذلك، كان التعريب أننا لاحظنا مستقلة عن موقع أو طبيعة العلامة حاتمة المستخدمة. التعبير عابر atlastin ربما كان لها تأثير على توزيعه، مع الإفراط في التعبير تشبع ER إلى جولجي مسارات النقل أو تؤثر على التوازن بين تقدمي ورجعية مسارات ER / جولجي، مما أدى إلى زيادة نسبية في ER تلطيخ بالمقارنة مع نمط الذاتية . وأخيرا، كان التوزيع المستمر للatlastin التي رأيناها في جميع أنحاء ER يست نموذجية للكتل مجمعة مميزة من الإفراط أعرب البروتينات التي تتجمع في ER. سوف تكون هناك حاجة إلى مزيد من الدراسات مع spastin وatlastin الأجسام المضادة إضافية لإيجاد حل نهائي للموقع التحت خلوية من التفاعل spastin atlastin.
أم لا توطين atlastin الأصلي هو الغالب في ER، في جولجي، أو على حد سواء، وحقيقة أنه يتفاعل مع spastin يجعل من المرجح جدا أن spastin تنشط في موقع الغشاء أكثر من واحد. حددنا سابقا CHMP1B البروتين endosomal كشريك ملزم للspastin ونحن نبين هنا أن كامل طول spastin جزئيا شارك يموضع مع GFP-VPS4-E235Q، علامة endosomal (27). ولذلك صورة تظهر من spastin كما بروتين التنظيم أنيبيب التي يمكن تجنيده من قبل البروتينات محول مختلفة لعدة مواقع غشاء، حيث يمكن أن تلعب دورا في تنظيم المحليين من الأنابيب الدقيقة، وربما إلى جانب لحركة العضيات بغشاء (خاصة في المحاور) و / أو إعادة تشكيل بنية عضية، أو حتى يكون لها دور منفصل تماما لا علاقة لها وظيفتها قطع أنيبيب. العوامل التي تؤثر على توظيف spastin لموقع واحد مقابل أخرى غير معروفة حتى الآن، ولكن سوف يكون من المهم توضيح الخاصة بهم في زيادة فهم دور الفسيولوجية الدقيق للبروتين.
قد يكون Spastin أيضا وظائف أخرى لا علاقة لها تفاعلات الغشاء. وأشارت العديد من الدراسات باستخدام الأجسام المضادة لspastin الذاتية أنه في بعض أنواع الخلايا أو في بعض مراحل دورة الخلية، قد يكون spastin توطين النووي (14، 15، 17). هذا spastin النووية تتكون في الغالب من القصير الإسوي اقتطاع N-محطة وظيفتها غير معروفة حاليا (18). سيناريو أحد أفراد العائلة AAA وجود مواقع متعددة من العمل ليس غير مسبوق، مع العديد من الأمثلة الموثقة من البروتينات AAA الفردية ممارسة وظيفة محددة، وغالبا ما تنطوي على تنظيم البروتين الركيزة التشكل، في مواقع متعددة داخل الخلايا العمل (38، 39).
درسنا المجالات spastin التي تتوسط التفاعل مع atlastin، والمنطقة المسؤولة يقيمون داخل بقايا 80 الأولى من البروتين (الشكل 6). وهكذا، إلا أن الغالب حشوية، كامل طول الإسوي spastin يحتوي على المنطقة المسؤولة عن ملزم لatlastin، مما يشير إلى أنها هي وظيفة هذا الإسوي التي تكتسي أهمية مباشرة لإمراض HSP. ومن المثير للاهتمام، وأثرى كامل طول الإسوي في الدماغ والحبل الشوكي، والمواقع التشريحية للHSP علم الأمراض (18). المنطقة ملزم atlastin تتداخل المجال (بقايا 50-87) هي المسؤولة عن الربط إلى الأنابيب الدقيقة والبروتين NA14 centrosomal، ولكن تتميز عن المنطقة التي تتفاعل مع CHMP1B (بقايا 81-194) (17، 19، 27) . وهكذا، يبدو أن تنعكس المواقع والوظائف spastin المختلفة التي تمت مناقشتها في وقت سابق وجود مواقع للبروتينات محول مختلفة في المنطقة-N محطة لها صفة الإلزام.
http://hmg.oxfordjournals.org/conten...7/F6.small.gif
الرقم 6. كارتون الرسم البياني للتفاعل بين spastin وatlastin. منطقة atlastin مسؤولة عن الربط لspastin تكمن N-محطة لأول TM. لspastin، المنطقة المسؤولة عن ملزم لatlastin يكمن داخل بقايا 80 الأولى من البروتين. هذا التداخل في المنطقة من البروتين (بقايا 50-87) هي المسؤولة عن الربط إلى الأنابيب الدقيقة، ولكن يختلف من معهد ماساتشوستس للتكنولوجيا وAAA أتباز المجالات.

يعرض دراستنا أيضا مزيد من المعلومات حول تكوين شعيرات الخلايا نشاهد في التعبير عن المسوخ spastin أتباز معيبة. على الرغم من أنه من غير المرجح أن هذه الخيوط هي ذات الصلة لتلك الطفرات التي تسبب haplo spastin-قصور وأنه من الممكن أن أنها تمثل الإفراط في التعبير الحرفية، قد يكون تكوينها ذات الصلة HSP الناجمة عن الطفرات spastin أتباز مغلطة. على مستوى المجهر الضوئي، atlastin الموسومة حاتمة وcalreticulin ER علامة كان كلا إعادة توزيعها على حزم أنيبيب غير طبيعية. في المجهر الإلكتروني في الخلايا المصابة بالعدوى بالنقل مع MYC-spastinK388R وatlastin-GFP، لاحظنا المجمعة الأنابيب الدقيقة والهياكل العسل غير طبيعية، والتي كان ينظر إليها في بعض الأحيان بالاشتراك مع حزم أنيبيب. في بعض الحالات، كان من الواضح أن الهياكل العسل كانت مستمرة مع ER العادي ومع الغلاف النووي، مما يشير إلى أنها قد تمثل ER غير طبيعي. وليس من الواضح ما إذا كانت إعادة تنظيم ER الذي شهدناه هو نتيجة للربط المباشر بين spastin متحولة وatlastin أو ما إذا كان لها تأثير غير مباشر عن طريق إعادة تنظيم شبكة أنيبيب المرتبطة ER، على الرغم من أنه يبدو واضحا أن خيوط ترتبط ارتباطا وثيقا مع مكونات الغشاء.
وباختصار، حددنا اثنين من البروتينات HSP، spastin وatlastin، كشركاء ملزم. هذا يشير إلى أن التسبب في HSP الناجمة عن طفرة في هذه البروتينات اثنين يرتبط في الأساس، ويوفر أول دليل تجريبي HSP قد تكون ناجمة عن خلل في البروتينات التي هي أعضاء في نفس مسار الكيمياء الحيوية. وهناك فهم أكثر تفصيلا وظيفة هذا المسار تعطي ليس فقط الأفكار الرئيسية في أسباب التنكس العصبي في HSP والحالات العصبية وربما غيرها ولكن يجب أيضا توضيح الآليات الجزيئية التي تعتبر مهمة للالمسالك طويلة صيانة العصبية.

المواد والأساليب

بناء الخميرة اثنين الهجين، GST والمناعي ناقلات

شيدت الخميرة Spastin يومين الهجين والتعبير الثدييات بنيات كما هو موضح سابقا (27، 40). وتضخمت بنيات Atlastin كل قراءة دليل PFX البلمرة (إينفيتروجن) PCR من IMAGE استنساخ 3869877، وذلك باستخدام بوابة TM (إينفيتروجن) إعادة التركيب استنساخ الاشعال المتوافقة مع نظام مصمم من تسلسل [كدنا مرجعية لكل الجينات. ليبني [كدنا مبتورة، PFX أجريت PCR خارج باستخدام المناسبة عبارة (إينفيتروجن) إعادة التركيب استنساخ الاشعال المتوافقة مع نظام مصمم من داخل كدنا] إشارة. تم بناء ناقلات دخول بوابة نظام إعادة التركيب استنساخ pENTR201 و / أو pENTR207 تحتوي على cDNAs تضخيم وفقا لتعليمات الشركة الصانعة. تم التحقق من تسلسل الدخول يبني ناقلات بواسطة التسلسل على ABI377 أو 3700 المنظم، وذلك باستخدام BigDyeDT الكيمياء (النظم البيولوجية التطبيقية).
ثم تم subcloned النصوص atlastin إلى ناقلات بوابة المتوافقة مع pcDNA3-C-Myc على و / أو pEGFP-N، الذي تضمن 5'-MYC أو 3'-GFP الحواتم، على التوالي. تم التحقق من التوجه للتسلسل atlastin داخل بنيات بواسطة التسلسل المباشر على ABI377 أو 3700 المنظم.
لإنتاج بنيات كدنا] GST الانصهار، وتضخمت كامل طول كدنا] spastin وatlastinΔTM كدنا] بواسطة PCR باستخدام PFU توربو ® إنزيم البلمرة (Stratagene). وقد صممت هذه البادئات المستخدمة في رد فعل لإنتاج منتج PCR مع 5 'و 3' ينتهي متوافقة مع GST الجينات الانصهار ناقلات، pGEX-4T-3 (أمرشام العلوم البيولوجية). بعد التقييد مع غير الأول وسال I (نيو إنجلاند Biolabs)، كان ligated المنتج PCR في ناقلات التعبير باستخدام T4 DNA يغاز (نيو إنجلاند Biolabs). تم التحقق من تسلسل يبني في وقت سابق.

إنتاج البروتينات GST الانصهار

تحويل GST الانصهار بناء إلى أجري BL21 (DE3) خلايا pLysS وفقا لتعليمات الشركة المنتجة (إينفيتروجن). أجريت إنتاج sonicates البكتيرية على نطاق واسع، وبعد ذلك GST الانصهار تنقية البروتين وفقا لتعليمات نظام GST الجينات الانصهار في أمرشام العلوم البيولوجية ".

الخميرة يومين الهجينة فحص مكتبة، المقايسات مراسل وتحديد البروتينات التفاعل

وقد أجريت الخميرة فحص هجين اثنين مع الطعم استنساخ spastin خارج كما هو موضح سابقا، باستثناء أجريت الشاشة ضد دماغ الجنين مكتبة كدنا] صانع عيدان الثقاب (Clontech) (27). للتعرف على التفاعل البروتينات، تم إدراج فريسة تضخيم مباشرة من الخميرة باستخدام بادئات ناقلات محددة، كما هو موضح سابقا، وكان التسلسل 3-5 ميكرولتر من كل منتج PCR كما هو موضح سابقا (27).
كما تم البحث في تسلسل فريسة ضد الإصدارات التي تعقد محليا من الانسان العاقل Unigene وقواعد البيانات EMBLminus باستخدام BLAST الآلي (41) الخوارزمية. استخدمت بنيت خصيصا حدات بيرل والكتابات على prefilter وتنسيق الإخراج BLAST الخام وتحديد ما إذا كان تسلسل 5 'قراءة تتداخل مع منطقة تشفير البروتين من الجين. مباريات فقط لمناطق تشفير البروتين المعروف والتكنولوجيات السليمة بيئيا التي لم تدرج إطار القراءة المفتوح الذي يعرف بأنه ايجابيات. تم استبعاد مباريات ل3'-UTRs والحمض النووي الجيني مع عدم وجود التنبؤ الجينات المرتبطة بها. مفرد، استبعدت أيضا التكنولوجيات السليمة بيئيا unspliced ​​التي لم تتوافق مع أي توقعات الجينات.

إعادة تأكيد وخصوصية اختبار الخميرة المقايسات يومين الهجينة

لإعادة اختبار كل تفاعل في الخميرة الطازجة، تم استنساخ المنتج PCR فريسة باستخدام بوابة نظام إعادة التركيب الاستنساخ في بوابة متوافق pGAD-G ناقلات، كما هو موضح سابقا. المختصة MAT تحولت α خلايا الخميرة PJ69-4A وتزاوج كما هو موضح سابقا. تم تزاوج هم مع الطعم ذات الصلة، واثنين من الطعوم ذات صلة مختلفة أو الطعم متجه فارغة، ثم حضنت ل> 5 ساعات على لوحات YPAD. وقد تم اختيار Diploids على SD-أورا / لوي قبل الاختبار لتفعيل مراسل عن طريق تكرار على SD-أورا / لوي / آدي.

الأجسام المضادة

الأجسام المضادة وحيدة النسيلة المضادة للMYC الأساسي (الماوس استنساخ 4A6) تم الحصول عليها من شمالي ولاية (نيويورك). تم الحصول على وحيدة النسيلة الأجسام المضادة لمكافحة أنيبيب (الفئران استنساخ YL1 / 2) ومكافحة GFP الأضداد الأرنب بولكلونل من Abcam (كامبردج). تم الحصول على الأرنب بولكلونل المضادة للcalreticulin الضد من Calbiochem (سان دييغو). تم الحصول على الأغنام بولكلونل المضادة للTGN46 من Serotec (أكسفورد)، وكان الأرنب بولكلونل مكافحة M6PR والماوس وحيدة النسيلة المضادة للLamp1 الأجسام المضادة المتوفرة في المنزل. تم الحصول على الماوس وحيدة النسيلة المضادة للEEA1 والماوس وحيدة النسيلة المضادة للGM130 من مختبرات تنبيغ دينار بحريني (أكسفورد). تم الحصول على الأجسام المضادة البيروكسيديز مترافق الثانوية للالنشاف الغربي من سيجما. تم الحصول على الأجسام المضادة الثانوية Alexafluor المسمى لالمناعي من المسابر الجزيئية (ولاية أوريغون). كان S51 أرنب المضادة للspastin الأجسام المضادة بولكلونل هدية كريمة من ايلينا Rugarli والأرنب مكافحة atlastin كان 5409 الضد هدية عينية من كريغ بلاكستون.

زراعة الخلايا، وترنسفكأيشن المناعي

وكانت المصنفة خلايا هيلا على العقيمة زلات غطاء زجاجي في لوحات ستة جيدا (~0.5 × 10 5 خلايا / جيد). بعد 24 ساعة، و transfected الخلايا مع ~400 نانوغرام من الحمض النووي ناقلات، وذلك باستخدام كاشف ترنسفكأيشن Effectene® (QIAGEN)، وفقا لتعليمات الشركة الصانعة. بعد ترنسفكأيشن، وحضنت الخلايا لمدة 24 أو 48 ساعة في المتوسط ​​RPMI-1640 (سيغما) تحتوي على 10٪ مصل بقري جنيني (FBS) (سيغما)، و 100 U / البنسلين مل و 100 ميكروغرام / مل الستربتومايسين (سيغما) و 2 م مل -glutamine (سيغما). وقد حافظت خلايا NSC34 في تعديل متوسطة Dulbecco والنسر (لايف تكنولوجيز)، على أن تستكمل في نفس الطريق باعتبارها وسيلة RPMI-1640 تستخدم لخلايا هيلا. كانت المصنفة خلايا NSC34 في 1 × 10 5 إلى لوحات ستة جيدا تحتوي على زلات غطاء زجاجي المكسوة مسبقا والمحمولة مع بولي د -lysine (سيغما). ثم تم transfected أنها عابر مع Effectene ترنسفكأيشن الكاشف (QIAGEN)، وفقا لتعليمات الشركة الصانعة، لمدة 24-48 ساعة قبل التثبيت.
بعد ترنسفكأيشن، وكانت تغسل الخلايا في برنامج تلفزيوني (سيغما) وثابت مع 4٪ الفورمالديهايد في برنامج تلفزيوني، في درجة حرارة الغرفة لمدة 15 دقيقة. وجرفت المياه خلايا ثابتة في برنامج تلفزيوني قبل permeabilized في برنامج تلفزيوني يحتوي على 0.1٪ تريتون X-100 (سيغما) أو 0.05٪ سابونين (سيغما، وتستخدم مع M6PR وLamp1 الأجسام المضادة) في درجة حرارة الغرفة لمدة 5-10 دقيقة. خلايا Permeabilized ثم تم غسلها ثلاث مرات في برنامج تلفزيوني، المحتضنة لمدة 15 دقيقة في عرقلة الحل (PBS، و 10٪ FBS، ± 0.05٪ سابونين) ومن ثم نقلها إلى عرقلة الحل الذي يحتوي على الأجسام المضادة حاتمة محددة المناسب في التخفيف المناسبة. بعد 60 دقيقة الحضانة، وجرفت المياه زلات غطاء ثلاث مرات في عرقلة الحل ثم تم حضنت لمدة 60 دقيقة في عرقلة العازلة التي تحتوي على الأجسام المضادة الثانوية المناسبة، بتركيز 1/300. تم زلات غطاء ثم يغسل ثلاث مرات في برنامج تلفزيوني ومرة واحدة في H المقطر 2 O، وبعد ذلك تم تركيبه في Vectashield TM (ناقلات مختبرات شركة) المتوسطة على شريحة زجاجية. وقد تم تحليل عينات الملون على زايس 510 المجهر متحد البؤر ميتا. وسجلت الصور باستخدام LSM صورة محلل البرمجيات، وتمت معالجة البيانات في وقت لاحق باستخدام برامج أدوبي فوتوشوب والمصور.

المجهر الإلكتروني

وأجري تثبيت وتجهيز أقسام للفحص المجهري وفقا لأساليب موضح سابقا (42).

التجارب المشتركة مناعي

عن محاولة المشارك مناعي من spastin الذاتية وatlastin في ظل ظروف غير تغيير طبيعة، كانت مطلية خلايا NSC34 untransfected إلى ثلاث لوحات 15 سم في 1 × 10 7. بعد مرور أربع وعشرين ساعة، وجرفت المياه خلايا متكدسة في برنامج تلفزيوني و lysed في 1 مل الجليد الباردة NP-40 العازلة تحلل (انظر 27 وصفة). ثم إزالة قسامة 100 ميكرولتر لاستخدامها بوصفها جزء مدخلات المركزة. وقدم حجم NSC34 المحللة تصل إلى 10 مل، وكان هذا الانقسام إلى اثنين من الكسور. جزء 1 يمثل مجموع المحللة الخلية، في حين تم طرد جزء 2 في 000 13 غرام لمدة 5 دقائق وطاف إزالة لاستخدامها بوصفها جزء القابلة للذوبان. ثم تم تقسيم كل من الكسور الى مزيد من 2.5 مل عينات لإيجابية / تحكم المشترك immunoprecipitations. ثم أضاف مكافحة atlastin أو مصل بولكلونل المضادة للspastin ل+ كسور في 1/100، في حين تم ادراج مكافحة GFP (ab290 Abcam) الأجسام المضادة للسيطرة على الكسور. ثم تم تحضين الكسور على طاولة هزاز في 4 درجة مئوية لمدة 4 ساعات. بعد حضانات الضد، تم إضافة 200 ميكرولتر من الطين 50٪ من البروتين-A حبات سيفاروز (سيغما) في NP-40 العازلة تحلل لجميع الكسور وحضنت بين عشية وضحاها على طاولة هزاز في 4 درجات مئوية. بعد حضانات البروتين الأجسام المضادة المعقدة، تم عزل بروتين-A حبات سيفاروز بواسطة الطرد المركزي وجيزة ثم تغسل خمس مرات لمدة 20 دقيقة في 10 مل NP-40 العازلة تحلل. ثم إزالة طاف غسل النهائي وكان معلق حبات في 2 × SDS-PAGE عينة العازلة. ثم تم إجراء SDS-PAGE وimmunoblotting نفذت مع أمصال مضادة المناسب.
لخلايا HEK293T عابر.، كانت مطلية الخلايا إلى قسمين 15 سم وحات في 1 × 10 7، وبعد 24 ساعة، خلايا وشارك transfected مع atlastin-GFP وMYC spastin أو pEGFP وMYC spastin. بعد أربع وعشرين ساعة ترنسفكأيشن، كانت هي lysed الخلايا في 1 مل الجليد الباردة العازلة تحلل، وقسامة 100 ميكرولتر إزالة لاستخدامها بوصفها جزء مدخلات المركزة. ثم تم معالجة الخلايا كما هو موضح لخلايا NSC34. تمت إضافة الجسم المضاد بولكلونل مكافحة GFP (Abcam ab290) ل+ الكسور الأجسام المضادة في 1/1000، و+/- ثم تم تحضين الكسور الأضداد على طاولة هزاز في 4 درجة مئوية لمدة 4 ساعات. وأجري مزيد من المعالجة بها في وقت سابق.
تم استخدام البروتوكول المعدل ل-immunoprecipitations شارك نفذت في ظل ظروف تغيير طبيعة. وقد أجريت هذه التجارب في الخلايا NSC34 باستخدام ظروف تغيير طبيعة في وجود الكيميائي عبر رابط DSP (بيرس). تم حصاد الخلايا NSC34 في برنامج تلفزيوني يحتوي على 1 م م DSP وحضنت لمدة 30 دقيقة في درجة حرارة الغرفة. 1 م تريس، حمض الهيدروكلوريك، pH7.5، وأضيف إلى تركيز النهائي من 10 م م لإرواء النشاط DSP وحضنت الخلايا لمدة 15 دقيقة أخرى في درجة حرارة الغرفة. ومعلق الخلايا في 100 ميكرولتر لكل 1 × 10 7 خلايا تغيير طبيعة العازلة تحلل تحتوي على 1٪ SDS، 50 م م تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4، 5 م م EDTA، الدناز الأول (سيغما) ومثبطات الأنزيم البروتيني (روش). ثم تم تخفيفه المحللة التشويه والتحريف إلى غير تغيير طبيعة العازلة تحلل تحتوي على 1٪ تريتون X-100، 50 م م تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.4، 300 م م كلوريد الصوديوم، 0.5 م م EDTA ومثبطات الأنزيم البروتيني إلى تركيز النهائي من 0.1٪ SDS. تم تطهير الكلي المحللة الخلية بواسطة الطرد المركزي في 000 دورة في الدقيقة 13 لمدة 10 دقيقة والإبقاء على جزء قابل للذوبان. تم precoupled الخرز البروتين-A سيفاروز إلى 20 ميكروغرام من مكافحة atlastin (5409) الأجسام المضادة بولكلونل وإلى عنصر تحكم الضد زائف (مكافحة GFP Abcam 6556)، في وجود DSP. وتطفأ النشاط DSP مع 10 م م تريس، حمض الهيدروكلوريك، في وقت سابق. ثم تم المضافة إلى جانب الأجسام المضادة الخرز البروتين-A سيفاروز إلى الخلية لست] القابلة للذوبان. سمح مجمعات للمستضد لتشكيل عند 4 درجة مئوية لمدة 2 ساعة. وكانت حبات ثم معزولة وغسلها عدة مرات في حالة عدم تغيير طبيعة العازلة تحلل. تم المشقوق DSP عبر ربط بإضافة SDS-PAGE عينة العازلة التي تحتوي على 5٪ β المركابتويثانول عند 100 درجة مئوية لمدة 5 دقائق والبروتينات تم حلها بواسطة SDS-PAGE.

البروتين GST الانصهار التجارب المنسدلة

تم غسلها الخرز الجلوتاثيون-سيفاروز (أمرشام العلوم البيولوجية) في منطقة عازلة المنسدلة التي تتألف من 1٪ NP-40 و PBS حل مع مثبطات الأنزيم البروتيني (أقراص كوكتيل الكامل البسيطة مثبط البروتياز، روش التشخيص) وتتكون لالطين 50٪ في هذا المخزن المؤقت. و transfected خلايا هيلا عابر مع بنيات ناقلات التعبير عن الموسومة حاتمة spastin أو atlastin، وذلك باستخدام مجموعة Effectene ترنسفكأيشن (QIAGEN)، كما هو موضح سابقا. تم حصاد الخلايا 24-48 ساعة بعد ترنسفكأيشن في غسل العازلة وتجميد / إذابة إلى -20 ° C.
تألف رد فعل المنسدلة 50 ميكرولتر من 50٪ الخرز الجلوتاثيون-سيفاروز، 500 العصارة الخلوية الخلية ميكروغرام و 100 ميكروغرام البروتين GST الانصهار. وجاء إجمالي حجم ما يصل الى 0.5 مل في أنبوب 1.5 مل مع العازلة المنسدلة (1٪ NP-40، PBS، 5 م م MgCl 2 و 5 م م ATP). سيطرة سلبية GST استخدمت مبلغ-متساو المولي من البروتين GST. وحضنت الأنابيب عند 4 درجات مئوية على الدورية بين عشية وضحاها عجلة القيادة. وقد نسج الخرز في 13 000 لمدة 15 ق في أعلى الطرد المركزي مقاعد البدلاء ثم تغسل مع 1 مل من العازلة. وتكررت هذه الدورة أربع مرات. قبل غسل الرابع، تم نقل مزيج المنسدلة لتنظيف أنابيب 1.5 مل للقضاء على أي ممكن ملزمة من البروتين إلى داخل أنبوب من البلاستيك. ومزال بروتين منضمة إلى حبات بعد أربعة دورات الغسيل / تدور مع 55 ميكرولتر من SDS عينة العازلة (188 م م تريس، 6٪ SDS، 30٪ الجلسرين، 0.03٪ برموفينول الأزرق، و 10٪ β المركابتويثانول، ودرجة الحموضة 6.8). تم تسخين العينات إلى 95 درجة مئوية لمدة 5 دقائق ثم نسج على 000 13 سرعة في أعلى الطرد المركزي مقاعد البدلاء لمدة 15 ثانية. تم تحميل supernatants على 10٪ SDS-بولكرلميد هلام وimmunoblotted مع مكافحة MYC أو مكافحة GFP الأجسام المضادة الأولية حسب الاقتضاء.

رافت ابراهيم 11-22-2015 08:48 PM

Oligomerization، وجمعية غشاء من راثي مشلول الشلل النصفي 3A (SPG3A) البروتين Atlastin
 
http://www.jbc.org/content/278/49/49063.full

ملخص

تضم paraplegias تشنجي وراثي مجموعة من المتلازمات غير متجانسة سريريا تتميز أقل التشنج أقصى والضعف، مع انحطاط المحاور البعيدة في تصاعدي طويلة ومساحات تنازلي من الحبل الشوكي. ويتسبب في وقت مبكر بداية راثي تشنجي الشلل النصفي SPG3A عن طفرات في atlastin / الإنسان ملزم guanylate البروتين 3 الجين (التي أعيدت تسميتها هنا atlastin-1)، الذي رموز لأحد أفراد 64 كيلو دالتون من dynamin / MX / ملزم guanylate البروتين الفصيلة GTPases من الكبيرة. يتم ترجمة البروتين atlastin-1 في الغالب في الدماغ، حيث يتم تخصيبه في الخلايا العصبية الهرمية في قشرة الدماغ والحصين. في العصبونات القشرية مثقف، atlastin-1 شارك المترجمة أبرزها مع علامات من جهاز جولجي، وكشف الفحص المجهري immunogold الإلكترون توطين السائد للatlastin-1 إلى رابطة الدول المستقلة -Golgi. وأظهرت التحليلات الخميرة يومين الهجينة والدراسات المشارك مناعي أن atlastin-1 يمكن الزميلة الذاتي، وهلام الاستبعاد اللوني والدراسات عبر ربط الكيميائية أشارت إلى أن atlastin-1 موجود باعتباره قليل وحدات في الجسم الحي، وعلى الأرجح tetramer. كشفت تجزئة الغشاء والمقايسات حماية البروتيني الذي atlastin-1 هو بروتين الغشاء لا يتجزأ مع توقع اثنين من المجالات عبر الغشاء. كل من يتعرض المجالات ملزم GTP وC-محطة N-الطرفية إلى السيتوبلازم. معا، وهذه النتائج تشير إلى أن بروتين SPG3A atlastin-1 هو multimeric لا يتجزأ GTPase الغشاء الذي يمكن أن تشارك في ديناميات غشاء جولجي أو الاتجار حويصلة.
القسم السابق القسم التالي
paraplegias تشنجي وراثي (شركائنا HSPs) 1 هي مجموعة من الاضطرابات العصبية تتميز بشكل رئيسي من قبل التشنج التدريجي وضعف في الأطراف السفلية (1 - 5). وعادة ما تظهر انحطاط محور عصبي في الأجزاء البعيدة من تصاعدي طويل الألياف العمود الظهري وتنازلي مساحات القشري من الحبل الشوكي، والتي تشكل أطول الحركية والحسية المحاور في النظام العصبي المركزي (6). تاريخيا تم تصنيفها شركائنا HSPs بأنها "نقية" أو "غير معقدة" في حالة حدوث الشلل النصفي التشنجي في عزلة و "معقدة" في حالة وجود تشوهات عصبية أخرى (7). وفي الآونة الأخيرة، يسمح بتحديد مواضع جينية جديدة لشركائنا HSPs تصنيف الجزيئي شركائنا HSPs (+2 - +5). من 20 مواضع معروفة (SPG1-20)، 11 هي مرض وراثي جسمي، ستة هي مقهورة، والثلاثة هم X-ربط. على الرغم من أن معظم المرضى HSP تجربة التدريجي تفاقم الأعراض، وبالنسبة للبعض، لا يظهر هذا الاضطراب أن تكون تقدمية (3، 4). وهكذا، على الرغم من أن بعض شركائنا HSPs بشكل واضح الاضطرابات العصبية (مثل SPG4)، والبعض الآخر مثل SPG1 (بسبب طفرات في L1 جزيء التصاق الخلية) وSPG3A (بسبب طفرات في GTPase atlastin) قد يكون من اضطرابات النمو العصبي (3، 4).
وقد تم تحديد ثمانية جينات المرض لشركائنا HSPs. واستنادا إلى البروتينات المعنية، وقد تقدمت عدة آليات المرضية. وتشمل هذه الإشارات الشاذة خلية أو الهجرة، تشوهات مرافقين الميتوكوندريا، شذوذ تكون الميالين، وعيوب في الاتجار داخل الخلايا والنقل (+2 - 5). البروتينات المتحورة في شركائنا HSPs التي تورطت في البروتين الخلوي أو الاتجار حويصلة تشمل KIF5A (SPG10)، spastin (SPG4)، spartin (SPG20؛ متلازمة تروير)، وatlastin (SPG3A) (استعراضها في المرجعان +2 - 5). KIF5A هو كينيسين العصبية السلسلة الثقيلة بروتين السيارات تشارك في نقل الجزيئات والعضيات غشائي على طول محور عصبي (8). Spastin، وهو عضو في AAA (لA TPases على ssociated مع مجموعة متنوعة من الأنشطة المحددة الخلوية) أسرة البروتين، الزميلة مع الأنابيب الدقيقة، وoverexpression spastin يسبب أنيبيب التفكيك (9). البروتين spartin يشبه VPS4، SNX15 (ق ن ه س ORTING IN-15)، وSKD1 البروتينات، التي تشارك في التشكل الاندوسوم والاتجار البروتين حجرات endosomal (10). شارك هذه البروتينات الأخيرة مع كل من spastin وspartin منطقة تسمى معهد ماساتشوستس للتكنولوجيا (الواردة في م icrotubule- ط nteracting ور rafficking الجزيئات) أو ESP (موجود في E nd13 / VPS4، S NX15، وP ALB) المجال (2، 11) . واستنادا إلى تشابهه مع أعضاء dynamin / MX / بروتين ملزمة guanylate (GBP) الفصيلة من GTPases كبيرة (12)، وatlastin البروتين SPG3A (التي أعيدت تسميتها هنا atlastin-1) وقد تورط في الاتجار داخل الخلايا، ولكن لا يعرف إلا القليل فيما يتعلق توطين الخلوية أو وظيفة (13).
بين شركائنا HSPs، SPG3A الجدير بالذكر بشكل خاص لبداية مبكرة جدا من الشلل النصفي التشنجي النقي. 1 atlastin تم الابلاغ عن خمسة الطفرات مغلطة واحد الإدراج قاعدة واحدة مع إنهاء السابق لأوانه توقع 558 الأحماض الأمينية المنطقة الترميز من (13 - 16). وكان قد تردد أن هذه الطفرات قد يغير هيكل، والتفاعلات، أو النشاط GTPase من atlastin-1 (+13 - +16). أعضاء من dynamin / MX / GBP الفصيلة، atlastin-1 هو الأكثر مشابهة لجيجابايت في الثانية. مثل جيجابايت في الثانية، atlastin-1 تمتلك حلقة RD بدلا من الكلاسيكي (N / T) تسلسل K X D داخل عزر الثالث من ثالوث الإجماع الملزم guanylate (13). ومع ذلك، atlastin-1 تفتقر إلى isoprenylation عزر-C محطة و-C محطة α12 / 13 الحلزون عزر، واثنين من السمات الهيكلية المميزة للعديد من جيجابايت في الثانية (12). هنا، علينا أن نبرهن على atlastin-1 هو GTPase بلازميدة قليلة القسيمات التي، على عكس جيجابايت في الثانية، وتتألف من وحدات فرعية التي هي بروتينات الغشاء لا يتجزأ، مع كل من N و C تيرميني تتعرض للمقصورة حشوية. Atlastin-1 يموضع بشكل بارز إلى جهاز جولجي وأثرت في الخلايا الهرمية القشرية الدماغية، جزء من السكان من الذي يحمل على "axonopathy طويلة" في المرضى الذين يعانون من SPG3A.

إجراءات تجريبية

وقد تم تحديد تسلسل Analysis- Atlastin-1 homologs مع انفجار (17). وقدمت تعيينات الكروموسومات باستخدام NCBI خريطة عارض. 2 الغشاء وتوقع المجالات حلزونية باستخدام نظام SOSUI (18). أجريت التحالفات البروتين مع ClustalW (19). حسبت التشابه تسلسل البروتين باستخدام تحليل BESTFIT (ولاية ويسكونسن الإصدار رزمة 10.3، Accelrys، سان دييغو، CA).
حقيقية النواة التركيبات التعبير الخلايا والحمض النووي Transfection- تسلسل الترميز الكامل للGTPase atlastin-1 (بنك الجينات ™ / بنك الإمارات الدولي رقم انضمام NM_015915 تم تضخيمه) من خلال PCR باستخدام PFU توربو (Stratagene، لا جولا، كاليفورنيا) من الدماغ البشري ماراثون (القشرة المخية ) مكتبة كدنا] (Clontech) وأكده تسلسل الحمض النووي. تم استنساخ [كدنا] بالطول atlastin-1 إلى موقع XmaI من حقيقية النواة pGW1 ناقلات التعبير مع Myc على أو هيماغلوتينين (HA) علامات حاتمة في محطة N كما هو موضح سابقا (20). تم استنساخ كامل طول atlastin-1 [كدنا أيضا في موقع XmaI من pRK5 (جينينتيك، جنوب سان فرانسيسكو، CA) للتعبير عن بروتين غير محدد. Torsin A (رقم القيد AF007871 تم استنساخ) مثل جزء HindIII-BglII إلى pGW1، الذي يسبق-C محطة Myc على العلامة في الإطار. تم تنفيذ موقع الموجه الطفرات باستخدام طريقة QuikChange (Stratagene). خلايا القرد الأخضر COS-7 الأفريقية (أمريكا نوع الثقافة مجموعة CRL-1651) تم الحفاظ عليها، transfected، وتحصد كما هو موضح سابقا (20).
Antibodies- الأجسام المضادة الانجذاب تنقية ضد بقايا 18/01 (رقم 5409؛ MAKNRRDRNSWGGFSEKTC-أميد) و544-558 (رقم 4735؛ أسيتيل CTPKSESTEQSEKKKM-OH) للأعدت atlastin-1 تجاريا (بيوسورس الدولية، هوبكينتون، MA) ، مع cysteines محطة تضاف إلى تسهيل اقتران. تم إعداد الأجسام المضادة أيضا ضد بقايا 947-960 (رقم 5174؛ أسيتيل CEKLDAFIEALHQEK-OH) من OPA1 البشرية / Mgm1 (بنك الجينات ™ / بنك الإمارات الدولي رقم انضمام NM_ 015560) (21، 22). وكانت الماوس وحيدة النسيلة المضادة للMyc على (9E10)، الأرنب بولكلونل مكافحة HA التحقيق (Y-11)، والماعز المضادة للcalregulin (T-19) الأجسام المضادة من سانتا كروز التكنولوجيا الحيوية (سانتا كروز، كاليفورنيا). الأرنب بولكلونل لمكافحة الصمم-خلل التوتر / وصفت البروتين 1 (DDP1) الأجسام المضادة TIMM8a سابقا (20). وكانت الماوس وحيدة النسيلة المضادة للcalnexin (مفتش 1)، ومكافحة GM130 (مفتش 1)، ومكافحة P115 (مفتش 1) الأجسام المضادة من Pharmingen. وكانت الماوس وحيدة النسيلة أضداد KDEL (استنساخ 10C3، مفتش 2A) من Stressgen في مجال التكنولوجيا الحيوية شركة (فكتوريا، كولومبيا البريطانية، كندا). تم الحصول على الماوس وحيدة النسيلة المرتبطة مكافحة أنيبيب البروتين-2 الأجسام المضادة (استنساخ HM-2، الماوس استسقاء) من سيجما.
وقد تم الحصول على الأنسجة إعداد والتحت خلوية Fractionation- الخليط الأنسجة البشرية من Clontech. أعدت الدماغ الكسور التحت خلوية من الفئران سبراغ داولي (150-175 غرام؛ مختبرات نهر تشارلز، ويلمنجتون، MA). والمتجانس العقول تشريح في 0.32 متر السكروز و 10 HEPES م م (7.4 درجة الحموضة) وطرد في 1330 × ز لمدة 3 دقائق، وتوليد بيليه (P1) وطاف (S1). تم طرد طاف S1 في 21200 × ز لمدة 10 دقيقة، مما ينتج عنه بيليه (P2) وطاف (S2). وبعد ذلك طرد طاف S2 في 200،000 × ز لمدة 1 ساعة، وتوليد بيليه P3 وطاف S3. تم تحديد تركيزات البروتين مقايسة BCA (بيرس) مع ألبومين المصل البقري كمعيار.
تم حل هلام الكهربائي وImmunoblotting- البروتينات بواسطة SDS-PAGE على 10 أو 14٪ والمواد الهلامية الأكريلاميد ونقل electrophoretically إلى النيتروسليلوز (Hybond ECL، أمرشام العلوم البيولوجية). بعد حجب مع الحليب الخالي 5٪، 0.1٪ توين 20، والمالحة تريس مخزنة (الرقم الهيدروجيني 7.4) بين عشية وضحاها، وأضيفت الأجسام المضادة (0،1-1،0 ميكروغرام / مل) لمدة 1 ساعة عند 25 ° C. بعد عدة غسلات مع 0.1٪ توين 20 و المالحة تريس مخزنة، الفجل-البيروكسيديز مترافق الأجسام المضادة الثانوية (1: 3000 تخفيف؛ أمرشام العلوم البيولوجية) وأضيفت لمدة 30 دقيقة. أخيرا، وبعد عدة يغسل مع العازلة حظر، تليها المالحة تريس مخزنة، تم الكشف عن البروتينات مناعيا باستخدام النهضة تعزيز كاشف التوهج (PERKINELMER علوم الحياة).
تم perfused Immunohistochemistry- ثلاثة الذكور البالغين سبراغ داولي الفئران (150-200 ز) transcardially تحت التخدير بنتوباربيتال العميق مع 0.9٪ كلوريد الصوديوم في 0.1 م العازلة الفوسفات (7.4 درجة الحموضة)، تليها 4٪ لامتصاص العرق، وأخيرا 10٪ سكروز في 0.1 م الفوسفات العازلة. العقول وظيفة ثابتة لمدة 1 ساعة وحضنت بين عشية وضحاها في الفوسفات مخزنة 30٪ سكروز. وبعد ذلك وضعت العقول على مشراح تجميد ومقطعة إلى المادتين 50 ميكرون سميكة. وقد تم جمع هذه المقاطع في الفوسفات مخزنة المالحة (PBS، ودرجة الحموضة 7.4) وتخزينها في -20 درجة مئوية في حل واق من البرد وتتألف من 30٪ سكروز و 30٪ جلايكول الإثيلين في 0.05 م العازلة الفوسفات (درجة الحموضة 7.2) حتى استخدامها.
وقد أجريت رد الفعل المناعى من استخدام عدة ABC النخبة (ناقلات مختبرات، وشركة، بورلنجام، CA) وفقا لتعليمات الشركة الصانعة. تم preincubated المقاطع في 1.0٪ مصل الماعز العادي (خ ع)، 10٪ ألبومين المصل البقري، وبرنامج تلفزيوني لمدة 30 دقيقة في درجة حرارة 25 مئوية ثم حضنت لمدة 48 ساعة عند 4 درجات مئوية مع الأجسام المضادة لمكافحة atlastin-1 (رقم 5409؛ 0.7 ميكروغرام / مل) في 0.1٪ NGS، 1٪ ألبومين المصل البقري، وبرنامج تلفزيوني. في تجارب السيطرة، وpreincubated المضادة للatlastin-1 الأجسام المضادة (رقم 5409) مع الببتيد مناعة (0.25 μ م) قبل استخدامها. وثم تشطف الأقسام مع برنامج تلفزيوني وحضنت مع مفتش المعقدة البيروكسيديز المضادة للأرنب (ناقلات مختبرات، وشركة) في برنامج تلفزيوني مع 1.5٪ NGS لمدة 1 ساعة عند 25 درجة مئوية. بعد الشطف مع PBS، حضنت المقاطع مع مجمع ABC (ناقلات مختبرات، وشركة) لمدة 45 دقيقة وتشطف مرة أخرى. تم الكشف عن الغلوثانيون تلطيخ باستخدام 3،3'-diaminobenzidine (مجموعة DAB سريعة، سيغما). وقد شنت المقاطع على Superfrost زائد الشرائح (فيشر)، المجففة، وcoverslipped مع Cytoseal 60 (ستيفنز العلمي، ريفرديل، NJ) المجفف في الهواء.
وأعدت العصبية الثقافة وImmunocytochemistry- الابتدائية ثقافات العصبونات القشرية الفئران الجنينية من الأجنة يوم 18 الفئران وصيانتها كما هو موضح سابقا (23). بعد 6 أيام في الثقافة، تم إصلاح الخلايا العصبية مع 4٪ الفورمالديهايد لمدة 30 دقيقة في درجة حرارة 25 مئوية. غسلها عدة مرات مع برنامج تلفزيوني. ثم permeabilized ومنعت لمدة 30 دقيقة في 5٪ NGS، 0.2٪ سابونين، وبرنامج تلفزيوني. وحضنت الخلايا بين عشية وضحاها في 4 درجات مئوية مع الأجسام المضادة ضد atlastin-1 (رقم 5409 و 10 ميكروغرام / مل)، وأنيبيب المرتبطة بروتين-2 (1: 200 تمييع)، P115 (0.5 ميكروغرام / مل)، GM130 (0.5 ميكروغرام / مل)، أو KDEL (1.9 ميكروغرام / مل) في 3٪ NGS، 0.05٪ سابونين، وبرنامج تلفزيوني. بعد غسل ثلاث مرات مع PBS، حضنت الخلايا مع اليكسا فلور 488- واليكسا فلور الأجسام المضادة الثانوية 568-مترافق (1: 500 التخفيف؛ المسابر الجزيئية، وشركة، يوجين، OR) في 3٪ NGS، 0.05٪ سابونين، وPBS لمدة 30 دقيقة، تليها ثلاث يغسل مع برنامج تلفزيوني. وكانت Coverslips ثم شنت باستخدام هلام / جبل (Biomeda، فوستر سيتي، كاليفورنيا). تم الحصول على صور الفلورسنت مع المسح الضوئي ليزر متحد البؤر المجهر زايس Axiovert 100M ومعالجتها مع برنامج أدوبي فوتوشوب.
أعدت Immunogold الكترون Microscopy- الفئران الثقافات الخلايا العصبية القشرية كما هو موضح أعلاه. بعد 6 أيام في الثقافة، تم إصلاح الخلايا العصبية مع بارافورمالدهيد 4٪ في 0.1 م العازلة الفوسفات (7.4 درجة الحموضة) لمدة 30 دقيقة ثم يغسل مع العازلة 0.1 م الفوسفات. تم permeabilized الخلايا ومنعت في 5٪ NGS، 0.1٪ سابونين، وبرنامج تلفزيوني لمدة 1 ساعة وحضنت مع مكافحة atlastin-1 الأجسام المضادة (رقم 5409) أو بدون الأجسام المضادة الأولية كعنصر تحكم في عرقلة العازلة لمدة 1 ساعة. بعد غسل مع 1٪ NGS في برنامج تلفزيوني مع 2٪ الحليب الخالي في برنامج تلفزيوني، وحضنت الخلايا مع 1.4 نانومتر Nanogold الذهب مترافق المضادة للأرنب الأجسام المضادة الثانوية (1: 250 التخفيف؛ Nanoprobes، Yaphank، NY) في 2٪ الحليب الخالي في برنامج تلفزيوني لمدة 1 ساعة. بعد غسل مع 2٪ الحليب الخالي في برنامج تلفزيوني، تم إصلاح الخلايا مع 2٪ غلوتارالدهيد في برنامج تلفزيوني لمدة 30 دقيقة. وأخيرا، فإن خلايا غسلها جيدا مع PBS والماء المقطر، محسنة الفضة (HQ طقم فضة، Nanoprobes)، وغسلها مرة أخرى بالماء و 0.1 م العازلة الفوسفات. تم علاج الخلايا مع 0.2٪ أوسو 4 في 0.1 م العازلة الفوسفات لمدة 30 دقيقة، mordanted ككل مع 0.25٪ خلات اليورانيل في المخزن خلات (الرقم الهيدروجيني 5.0) بين عشية وضحاها، وغسلها والمجففة مع تركيزات المسلسل من الإيثانول، وأخيرا تسلل وجزءا لا يتجزأ من راتنجات الايبوكسي. أقسام رقيقة من ~70 نانومتر كانت counterstained مع خلات اليورانيل وسترات الرصاص وفحصها تحت المجهر الإلكتروني JEOL 1200 نقل EXII. وقد تم جمع الصور الرقمية مع كاميرا XR-100 CCD (تقنيات متقدمة الميكروسكوب، دانفرس، MA).
جمعية غشاء Assays- COS-7 خلايا overexpressing تم غسلها atlastin-1 مرتين مع 10 م م تريس، حمض الهيدروكلوريك (7.5 درجة الحموضة) ومن ثم تحصد في 10 م م تريس، حمض الهيدروكلوريك (7.5 درجة الحموضة)، 10 م م كلوريد الصوديوم، و 1.5 م م MgCl 2. بعد مرور عدة من خلال إبرة عيار 25، وطرد جناسة في 1330 × ز. كان sonicated طاف ما بعد النووي ومن ثم recentrifuged في 200،000 × ز لمدة 60 دقيقة، مما أسفر عن بيليه (هي lysed جزء الغشاء) وجزء للذوبان. كان يعالج جزء الغشاء مع 1 م كلوريد الصوديوم و 25 م عازلة م الفوسفات (7.4 درجة الحموضة)، مع 100 متر عازلة م الجلايسين (درجة الحموضة 2.8)، مع 100 متر عازلة م كربونات (درجة الحموضة 11.0)، مع 0.1٪ تريتون X-100 و PBS، أو مع 1.0٪ deoxycholate الصوديوم وPBS كما هو مبين وطرد على 200،000 × ز لمدة 60 دقيقة لتوليد بيليه النهائي وطاف. في تجارب أخرى، أعدت كسور قابلة للذوبان وغشاء من COS-7 خلايا overexpressing Myc على الموسومة البرية من نوع atlastin-1 أو مختلف MYC الموسومة atlastin-1 بنيات الحذف. ثم تم immunoblotted بنسب متساوية من الكسور القابلة للذوبان والغشاء مع أضداد Myc على. تعرض الأغشية من الخلايا COS-7 overexpressing لازال الكسور atlastin-1 و غشاء P3 أعدت من دماغ الفئران للتخلص التقسيم مع تريتون X-114 كما وصفها برودييه (24)، وبنسب متساوية من مائي والمنظفات مراحل تم immunoblotted مع anti -atlastin-1 الأجسام المضادة (رقم 5409).
1 atlastin تم غسلها البروتيني الهضم وDeglycosylation Assays- COS-7 خلايا overexpressing غير محدد مرتين مع 10 م م تريس، حمض الهيدروكلوريك (7.5 درجة الحموضة) ومن ثم جمعها في 10 م م تريس، حمض الهيدروكلوريك (7.5 درجة الحموضة)، 10 م م كلوريد الصوديوم، 1.5 م م MgCl 2، و 10٪ سكروز. صدرت الخلايا من خلال إبرة عيار 25، وطرد جناسة في 3000 × ز لمدة 3 دقائق. تم تجاهل بيليه، وطرد طاف في 130،000 × ز لمدة 60 دقيقة. كان معلق هذا بيليه الأخير في المخزن نفسه مع أو بدون بروتين K (EC 3.4.21.64؛ سيغما) في أي من 50 μ م (30 دقيقة، 25 ° C) أو 200 μ م (15 دقيقة، 37 ° C). أنهيت ردود الفعل مع 2 م م phenylmethylsulfonyl الفلورايد، يليه مباشرة تحلل في SDS-PAGE عينة العازلة. ثم تم immunoblotted العينات مع الأجسام المضادة ضد محطة C (رقم 4735) أو N محطة (رقم 5409) من atlastin-1 أو مع أضداد calregulin. تم تنفيذ كما هو موضح سابقا (؛ deglycosylation بروتين الببتيد مع N -glycosidase F (نيو إنجلاند Biolabs شركة، بيفرلي، MA EC 3.5.1.52) 25).
أجريت الخميرة ثنائي هجين الخميرة Tests- الاختبارين الهجين باستخدام الخميرة سلالة L40 إيواء الجينات مراسل HIS3 وβ غالاكتوزيداز تحت سيطرة مواقع ملزم LexA المنبع كما هو موضح سابقا (20). أنتجت Atlastin-1 بنيات الحذف بواسطة PCR التضخيم باستخدام PFU توربو واستنسخ في الإطار إلى pGAD10 الفريسة وpBHA ناقلات الطعم (Clontech). وقد أكد كل بنيات من تسلسل الحمض النووي. كان يعاير قوة التفاعل من قبل بيتا غالاكتوزيداز وHIS3 الاستقراء كما هو موضح سابقا (20).
الخلايا COS-7 مناعي والكيميائية عبر linking- شارك transfected مع HA- وMyc على-atlastin-1 أو مع transfected Myc على-atlastin-1 تم غسلها وحدها مرتين مع برنامج تلفزيوني ثم تحصد في 0.5٪ تريتون X-100 و PBS و وأوضحت بواسطة الطرد المركزي في 130،000 × ز لمدة 30 دقيقة. وحضنت مقتطفات (100 ميكروغرام من البروتين) لمدة 1-2 ساعات في 4 درجة مئوية مع 5 ميكروغرام من أرنب بولكلونل مكافحة HA الأجسام المضادة التحقيق (Y-11) إلى جانب مسبقا إلى البروتين A-سيفاروز CL-4B (أمرشام العلوم البيولوجية). تم غسلها حبات ثلاث مرات مع 0.5٪ تريتون X-100 و PBS. تم حل البروتينات ملزمة SDS-PAGE وimmunoblotted مع الماوس وحيدة النسيلة المضادة للأضداد Myc على. تم إجراء الكيميائية مع dithiobis (succinimidyl بروبيونات) ربط الصليب (بيرس) باستخدام الكريات سرعة عالية من طاف بعد النووي المستمدة من Myc على-atlastin-1-overexpressing الخلايا COS-7. تمت إضافة الكريات ومعلق في برنامج تلفزيوني، وdithiobis (succinimidyl بروبيونات) لمدة 30 دقيقة على الجليد. تم حل المنتجات المرتبطة الشاملة التي SDS-PAGE تحت ظروف امختزل وimmunoblotted مع الأجسام المضادة لمكافحة Myc على.
هلام استبعاد FPLC- Myc على الموسومة من النوع البري أو حذف المسوخ من atlastin-1 overexpressed في COS-7 خلايا كانت هي lysed في 0.1٪ تريتون X-100 و PBS وأوضحت بواسطة الطرد المركزي في 130،000 × ز لمدة 30 دقيقة. تم تطبيق استخراج القابلة للذوبان إلى Superdex 200 HR10 / 30 FPLC العمود (أمرشام العلوم البيولوجية) بمعدل تدفق 0،25 مل / دقيقة في 0.1٪ تريتون X-100 و PBS. تم جمع الكسور (0.25 مل)، وحلت البروتينات بواسطة SDS-PAGE ثم immunoblotted باستخدام أجسام مضادة لمكافحة Myc على. تم تطبيق معايير البروتين (سيغما وأمرشام العلوم البيولوجية) في 0.1٪ تريتون X-100 و PBS إلى العمود لتوليد منحنى القياسية، والتي تم حساب الجماهير الجزيئية الأم لمن النوع البري وطفرات حذف atlastin-1.
GTPase آخر Assays- وكدنا] atlastin-1 وsubcloned إلى pCAL-N-EK لإنتاج ملزم كالمودولين الببتيد (CBP) البروتينات الانصهار (Stratagene). وكان المستحث التعبير عن CBP-atlastin-1 في القولونية BL21 (DE3) من خلال 100 μ M-الآيزوبروبيل β- د -thiogalactopyranoside ل 4.5 ساعة عند 25 ° C. بعد التكوير، ومعلق الخلايا في 50 م م تريس، حمض الهيدروكلوريك (8.0 درجة الحموضة)، 150 م م كلوريد الصوديوم، 5 م م MgCl 2، 2 م م CaCl 2، 10٪ الجلسرين، 10 م م β المركابتويثانول، 1.0٪ تريتون X وأوضح -100، و 0.5 م م phenylmethylsulfonyl الفلورايد وتمزق من قبل اثنين من الممرات من خلال خلية الضغوط الفرنسية على 10000 رطل استخراج بواسطة الطرد المركزي في 50000 × ز لمدة 30 دقيقة ومن ثم تطبيقها على الراتنج كالمودولين تقارب (Stratagene). بعد غسل مع 50 م م تريس، حمض الهيدروكلوريك (8.0 درجة الحموضة)، 150 م م كلوريد الصوديوم، 5 م م MgCl 2، 2 م م CaCl 2، 10 م م β المركابتويثانول، و 0.1٪ تريتون X-100، وكانت البروتينات الانصهار ملزمة مزال مع 50 م م تريس، حمض الهيدروكلوريك (8.0 درجة الحموضة)، 150 م م كلوريد الصوديوم، و 10 م م β المركابتويثانول، 2 م م EGTA، و 0.1٪ تريتون X-100. كان مدال-تنقية تقارب CBP-atlastin-1 انصهار بروتين ضد عازلة فحص (20 م م HEPES (درجة الحموضة 7.2)، 2 م م MgCl 2، و 1 م م dithiothreitol). وشمل خليط التفاعل لفحص GTPase مدال CBP-atlastin-1 مع 0.05٪ ألبومين المصل البقري و0.825 μ م [α- 32 P] GTP (3000 تسى / مليمول؛ ICN Biomedicals، إرفين، كاليفورنيا) في المخزن الفحص. وقد شوهدت عينات من خليط التفاعل عند نقاط زمنية مختلفة (0-60 دقيقة) على السليلوز polyethyleneimine على لوحات البوليستر TLC (سيغما). تم فصل النيوكليوتيدات جوانين التي كتبها تصاعدي اللوني في 1 م LiCl و 1.2 متر حمض الفورميك. و[32 P] الناتج المحلي الإجمالي، وحددت [32 P] البقع GTP، وكان كميا شدة باستخدام PhosphorImager والبرمجيات ImageQuant (أمرشام العلوم البيولوجية). وأعرب عن النشاط GTPase كنسبة من الناتج المحلي الإجمالي لمجموع النيوكليوتيدات جوانين (GTP + GDP) في كل نقطة زمنية.

النتائج

Atlastin عائلة GTP ملزم Proteins- بحثنا النوكليوتيدات والبروتين قواعد بيانات لبروتينات بشرية مماثلة لatlastin (التي أعيدت تسميتها atlastin-1) وجدت اثنين من البروتينات ذات الصلة للغاية (الشكل 1). واحد، والتي تم تحديدها سابقا ARL-6-التفاعل البروتين 2 (بنك الجينات ™ / بنك الإمارات الدولي رقم انضمام NM_022374)، أننا قمنا بتغيير اسم atlastin-2. الآخر قمنا اسمه atlastin-3 (انضمام عدد AK097588). في حين تم العثور على الجين atlastin-1 على 14q22.1 الصبغي (ID موضع 51062)، يموضع الجين atlastin-2 إلى 2p22.3 كروموسوم (ID موضع 64225)، وهذا الجين atlastin-3 إلى الكروموسوم 11q13.1 (ID مكان 25923). تظهر هذه البروتينات التماثل واسعة، مع نواة مركزية كبيرة من أعلى التشابه التي تضم منطقة ملزم GTP في الجزء N-المحطة. يحدث أكبر قدر من الاختلاف في C و N تيرميني (الشكل 1). هناك 69٪ الهوية الأحماض الأمينية و 79٪ تشابه بين atlastin-1 وatlastin-2 على 533 بقايا و 66٪ الهوية المركزية و 75٪ تشابه بين atlastin-1 وatlastin-3 على 476 المخلفات. Atlastin-2 والهوية atlastin-3 حصة 67٪ و 78٪ تشابه أكثر من 482 المخلفات. أيضا، توقع اثنين من اللوالب عبر الغشاء (SOSUI) (18 تم حفظها) في جميع البروتينات الثلاثة. باستخدام نفس البرنامج التنبؤ SOSUI، GBP1 البشري (عدد الانضمام NM_002053) والمتعلقة GTPase ماج 2 (عدد الانضمام M81128) عدم وجود أي توقع المجالات عبر الغشاء، بما يتفق مع التقارير السابقة (12). تسلسل توافق في الآراء بشأن N -linked بالغليكوزيل وMYB DNA ملزمة سابقا ذكرت لatlastin-1 (13) لا يتم حفظها في atlastin-2 وatlastin-3 (الشكل 1).
http://www.jbc.org/content/278/49/49063/F1.small.gif
F IG. 1.
. عائلة Atlastin من البروتينات في البشر Atlastin (التي أعيدت تسميتها هنا atlastin-1 (ATL1)) هي مشابهة جدا لاثنين من البروتينات لدينا اسم atlastin 2 (ATL2، ويعرف أيضا باسم ARL-6-التفاعل البروتين 2) وatlastin-3 (ATL3 ). مظللة بقايا متطابقة في جميع البروتينات ثلاثة البرتقال، وتلك متطابقة في اثنين من البروتينات ثلاثة مظللة الأخضر. خطوط عريضة تشير إلى توقع المجالات عبر الغشاء. ومحاصر الزخارف ملزم GTP. النجمة للدلالة مواقع الطفرات مغلطة في المرضى الذين يعانون من SPG3A. يتم حفظها بشدة هذه المخلفات في atlastin-2 وatlastin-3. سهم يصادف موقع طفرة انزياح الإطار في عائلة واحدة مع SPG3A. مواقع توافق في الآراء بشأن N -linked بالغليكوزيل (#) والحمض النووي ملزم نطاق MYB (^) في atlastin-1 يشار؛ هي الحفاظ أيا من هذه في كل atlastin-2 وatlastin-3. A البديل من atlastin-3 مع الإدراج حمض 26-الأمينية التالية سر 74 (بنك الجينات ™ / بنك الإمارات الدولي رقم انضمام CAB56010) والبديل من atlastin-2 مع محطة رواية C (38 بقايا) التالية فال 545 (انضمام عدد AAM97342)، سواء الناتجة عن الربط البديلة، كما تم الإبلاغ عنها.

تحديد والتحت خلوية توطين Atlastin-1 بروتين ولدت أضداد الببتيد محددة ضد متباينة N (رقم 5409) وC (رقم 4705) تيرميني من atlastin-1. تم الكشف عن Atlastin-1 في ~64 كيلو دالتون على immunoblots من الخليط من COS-7 الخلايا، بما يتفق مع حجمها المتوقع، ولكن ليس في تلك الخلايا من untransfected (atlastin-1-overexpressing الشكل 2 A). وتم الحصول على نتائج مماثلة مع أضداد الببتيد التي أثيرت ضد كل من N (الشكل 2 A) وC (لا تظهر البيانات) تيرميني. تم الكشف عن Atlastin-1 أيضا في الخليط من أنسجة الفئران والدماغ البشري، مع عدم الرد عبر العصابات البروتين (الشكل 2 A). تم إلغاء إشارة مناعيا عندما preadsorbed الأجسام المضادة مع الببتيد مناعة (1 μ م) (لا تظهر البيانات). والأكثر ثراء Atlastin-1 في المخ، ولكن كان حاضرا أيضا في العديد من الأنسجة البشرية الأخرى في مستويات أقل من ذلك بكثير (الشكل 2 B). وعلى سبيل المقارنة، كان الميتوكوندريا البروتين الفضاء intermembrane DDP1 / TIMM8a توزيع الأنسجة أكثر تجانسا (الشكل 2 B). درسنا توطين التحت خلوية من atlastin-1 باستخدام الكسور الدماغ الفئران بواسطة الطرد المركزي التفاضلي (إعداد الشكل 2 C). وقد أثرى كلا atlastin-1 وهيولي باطني البروتين شبكية calregulin في جزء الميكروسومي P3. في المقابل، كان الميتوكوندريا البروتين OPA1 / Mgm1 الأكثر وفرة في بيليه P2، مع مستويات أقل من ذلك بكثير في جزء P3.
http://www.jbc.org/content/278/49/49063/F2.small.gif
F IG. 2.
توطين التحت خلوية من atlastin-1. توصيف بولكلونل مكافحة atlastin-1 الأجسام المضادة. تم immunoblotted؛ لست] من همية transfected (10 ميكروغرام من البروتين / حارة) أو atlastin-1 (AT1) -transfected (5 ميكروغرام من البروتين) COS-7 الخلايا وكذلك الخليط الدماغ البشري والفئران (20 ميكروغرام من البروتين H) مع الأجسام المضادة ضد atlastin-1 (رقم 5409). وترد الهجرات المعايير الكتلة الجزيئية (في kilodaltons). توزيع الأنسجة من atlastin-1. جرى التحقيق مجموع الخليط (20 ميكروغرام / حارة) من الأنسجة البشرية المشار إليها مع الأجسام المضادة لمكافحة atlastin-1 (رقم 5409) أو معاداة DDP / TIMM8a (DDP1) ن خ الأجسام المضادة، على نحو سلس؛... كورونا، الهيكل العظمي C. تجزئة البيوكيميائية من atlastin-1. تم إعداد الكسور التحت خلوية من دماغ الفئران بواسطة الطرد المركزي التفاضلي (انظر "الإجراءات التجريبية" لمزيد من التفاصيل). تم immunoblotted الكسور (20 ميكروغرام من البروتين / لين) مع الأجسام المضادة لatlastin-1 (رقم 5409)، وهيولي باطني البروتين شبكية calregulin (Calreg)، والبروتين OPA1 الميتوكوندريا.

درسنا توطين الذاتية atlastin-1 في أقسام دماغ الفئران باستخدام الأجسام المضادة الناتجة ضد N محطة من atlastin-1 (رقم 5409) (الشكل 3). كانت خلايا immunopositive غاية الأكثر وفرة في الصفيحة V من القشرة الدماغية، بما في ذلك القشرة الحركية. على الرغم من أن سوما الخلايا العصبية وصفت بشدة، كانت ملطخة أيضا شجرة شجيري (الشكل 3، A-C). وكان القضاء المناعية عندما preadsorbed الأضداد المضادة للatlastin-1 لأول مرة مع الببتيد مناعة (الشكل 3 D). كان وضع العلامات أيضا بارز في قرن آمون، لا سيما في الخلايا العصبية الهرمية في CA1 CA3 و(الشكل E و F). من ناحية أخرى، لم يكن هناك أي تلطيخ للكشف في المخيخ. على الرغم من مناعية قليلة كان حاضرا في المخطط، مع المناعية المعتدل يقتصر على جزء من السكان من الخلايا العصبية كوليني كبيرة، وتلطيخ أكثر قوة واضحا في الخلايا العصبية داخل اللوزة والعديد من النوى المهادية. 3 A عدد الخلايا في عدة نوى mesopontine، بما في ذلك substantia الظهرية المادة الرمادية في الدماغ بارس المكتنزة ومنطقة retrorubal، ملطخة باعتدال. 3
http://www.jbc.org/content/278/49/49063/F3.small.gif
F IG. 3.
توطين Immunocytochemical من atlastin-1 في دماغ الفئران. atlastin-1 هو وفرة في الخلايا الهرمية في الصفيحة V من القشرة الدماغية. B و C والصور التكبير أعلى من هذه الخلايا الهرمية القشرية تظهر مناعية شديدة في سوما وشجرة شجيري . preadsorption من الأجسام المضادة لمكافحة atlastin-1 (رقم 5409) مع الببتيد مناعة القضاء على المناعية محددة في قشرة الدماغ (قارن مع B). E و الخلايا الهرمية في المنطقة CA1 من الحصين تظهر أيضا immunolabeling القوي للمقصورة somatodendritic. أشرطة النطاق = 200 ميكرومتر (A)، 50 ميكرون (B، D و E)، و 25 ميكرون (C و F).

لإنشاء توطين atlastin-1 على مستوى التحت خلوية، تم فحص مثقف الخلايا العصبية القشرية الدماغية باستخدام مزدوج التسمية المناعي. تم العثور Atlastin-1 تلطيخ أبرزها في سوما الخلية، مع تلطيخ ضعف في العمليات العصبية، التي تضم كلا من المحاور والتشعبات (الشكل 4). وقد شارك في توطين محدودة للغاية مع علامات للالشبكة الإندوبلازمية (أضداد KDEL)، وكان ينظر أي تداخل من atlastin-1 وضع العلامات مع الميتوكوندريا ملطخة MitoTracker CMXRos (لا تظهر البيانات). ومع ذلك، P115، وهي علامة للحصول على جهاز جولجي، بإحكام شارك المترجمة مع atlastin-1 (الشكل 4، A-C). واعتبر المشاركة في توطين مع atlastin-1 أيضا مع علامة GM130 جولجي، ولكن بدرجة أقل (لا تظهر البيانات). تم حجب إشارة مناعيا atlastin-1 من قبل preadsorption من الأجسام المضادة مع الببتيد مناعة (لا تظهر البيانات). في التعرض أطول، كان ينظر منقط تلطيخ في التشعبات والمحاور (الشكل 4، D-F). ومع ذلك، كان هذا تلطيخ أقل كثافة بكثير من تلك التي شوهدت المرتبطة جهاز جولجي في خلايا الجسم العصبية.
http://www.jbc.org/content/278/49/49063/F4.small.gif
F IG. 4.
. توطين التحت خلوية من atlastin-1 إلى جهاز جولجي بالنقر المزدوج التسمية المناعي يظهر هو المشارك توطين atlastin-1 المناعية (أحمر، A) مع P115 جولجي علامة (الأخضر؛ B). وأظهرت الصورة المدمجة في C. في التعرض أطول، خافت atlastin-1 المناعية (الأحمر؛ D) غير مرئية داخل التشعبات (الأسهم الصغيرة)، والتي تم تحديدها من قبل costaining مع المرتبطة مكافحة أنيبيب الأجسام المضادة بروتين-2 (الأخضر؛ E)، والمحاور (النصال ). يظهر الصورة المدمجة في F. الحانات النطاق = 20 ميكرومتر.

لتأكيد هيمنة جولجي من الذاتية atlastin-1 بروتين، درسنا توطين atlastin-1 في الخلايا العصبية القشرية مثقف من قبل immunogold المجهر الإلكتروني (الشكل 5). وفرة من العلامات immunogold زينت جهاز جولجي، في الغالب رابطة الدول المستقلة -Golgi صهاريج (الشكل A و B). كان هذا وضع العلامات غير موجودة في أقسام التحكم التي تم حذف الأجسام المضادة الأولية (الشكل C و D). واعتبر أي تلطيخ محددة في الميتوكوندريا أو في النواة.
http://www.jbc.org/content/278/49/49063/F5.small.gif
F IG. 5.
توطين التحت خلوية من atlastin-1 إلى جهاز جولجي من قبل immunogold المجهر الإلكتروني. A و B، توطين atlastin-1 داخل جهاز جولجي، وخاصة رابطة الدول المستقلة -Golgi صهاريج. C و D، أقسام التحكم فيها الانتخابات التمهيدية المناهضة للatlastin- 1 antibodies were omitted. Scale bars = 500 nm ( A and C ) and 100 nm ( B and D ).

Atlastin-1 هل يتجزأ غشاء بروتين استنادا إلى نتائج تجزيء التحت خلوية وimmunolabeling، درسنا ما إذا atlastin-1 هو الغشاء لا يتجزأ أو بإحكام غشاء المرتبطة البروتين جولجي، ومقارنتها مع البروتينات المعروفة تحت مختلف الظروف استخراج الغشاء. Atlastin-1 overexpressed في الخلايا COS-7 تقسيم حصرا لكسر الغشاء، الذي كان قد هي lysed صوتنة للافراج عن البروتينات اللمعية القابلة للذوبان وتعرض لتنبيذ فائق (الشكل 6 A). والجدير بالذكر، تم العثور على نسبة كبيرة من البروتين للذوبان اللمعية calregulin في طاف، مؤكدا تحلل كفاءة microsomes ل. تم العثور على بروتين الغشاء لا يتجزأ calnexin حصرا في جزء الغشاء (الشكل 6 A). وقد تعرض هذا جزء الغشاء لمختلف الظروف استخراج (أي ملح عالية، وانخفاض درجة الحموضة، ودرجة الحموضة العالية، والمنظفات الصناعية) لتحديد ما إذا atlastin-1 هو بروتين الغشاء لا يتجزأ. Atlastin-1 تقسيم لطاف بطريقة مشابهة للبروتين الغشاء لا يتجزأ calnexin. لا atlastin-1 أفرج عنه ولا calnexin من جزء الغشاء مخازن درجة الحموضة منخفضة أو عالية، ولكن كلا atlastin-1 وcalnexin تم solubilized بكفاءة عن طريق المنظفات (الشكل 6 A). في المقابل، تم الإفراج عن جزء المرتبطة غشاء calregulin من الأغشية ليس فقط عن طريق المنظفات، ولكن أيضا من جانب كل من مخازن درجة الحموضة العالية والمنخفضة (الشكل 6 A). مرحلة التقسيم مع تريتون X-114 تظاهر توزيع atlastin-1 في الغالب إلى مرحلة المنظفات، في حين تم العثور على غشاء المرتبطة قابل للذوبان البروتين calregulin في المرحلة المائية (الشكل 6 B).
http://www.jbc.org/content/278/49/49063/F6.small.gif
F IG. 6.
Atlastin-1 هو بروتين الغشاء لا يتجزأ. A، جمعية غشاء atlastin-1. و transfected COS-7 الخلايا مع غير محدد atlastin-1. Atlastin-1 مجزأة في غشاء الكرية هي lysed (Memb)، ولكن ليس جزء عصاري خلوي للذوبان (سول) المستمدة من ارتفاع الطرد المركزي سرعة طاف ما بعد النووي (Homog)، والكشف عنها من قبل immunoblotting مع مكافحة atlastin-1 الأجسام المضادة. كان معلق هذا بيليه في وقت لاحق في أملاح المحددة أو المنظفات ثم refractionated عن ارتفاع الطرد المركزي بسرعة إلى طاف (S) وبيليه غشاء (P). وأطلق سراح Atlastin-1 من الأغشية بطريقة مشابهة لغشاء لا يتجزأ من البروتين calnexin، ولكن ليس للبروتين calregulin القابلة للذوبان وغشاء المرتبطة. DOC، 1.0٪ deoxycholate الصوديوم، TX-100، 0.1٪ تريتون X-100 B، تريتون X-114 مرحلة التقسيم. تم تقسيم الأغشية من atlastin-1 transfected-COS-7 الخلايا والفئران الدماغ الكسور P3 مع تريتون X-114 (TX-114)، وقسامات من المواد ابتداء من (المدخلات) وكذلك مائي والمنظفات (تريتون X-114) تم immunoblotted مراحل مع أضداد calregulin مكافحة atlastin-1 و. وقد أثرى Atlastin-1 في المرحلة المنظفات، في حين تم العثور على calregulin في المرحلة المائية. C، يطلب من المجالات مسعور من atlastin-1 للجمعية الغشاء. supernatants آخر النووية من COS-7 الخلايا المصابة بالعدوى بالنقل مع ومجزأة من النوع البري atlastin-1 أو حذف المسوخ كما هو موضح لMyc على الموسومة A وimmunoblotted مع الأجسام المضادة لمكافحة Myc على. حذف كل من توقع المجالات عبر الغشاء (H)، ولكن N- وC-محطة الحذف ليس أصغر، وانخفاض ملحوظ جمعية غشاء atlastin-1 (السهم). يشار إلى الأحماض الأمينية الحدود.

لتحديد ما إذا كان اثنين من المجالات مسعور في atlastin-1 تمثل المجالات عبر الغشاء، استخدمنا عدة Myc على الموسومة N- وC-محطة atlastin-1 الحذف لتقييم التوطين لطاف أو الكسور غشاء (الشكل 6 C). كان من النوع البري atlastin-1 موجودة في جزء الغشاء، ولم الحذف صغيرة في N وC تيرميني لا يغير من جمعية الغشاء بشكل ملحوظ (الشكل 6 C). ومع ذلك، توقع الحذف-C المحطة أن إزالة اثنين من المجالات عبر الغشاء، atlastin-1- (1-447)، تسبب في إعادة توزيع البروتين إلى جزء طاف (الشكل 6 C)، مشيرا إلى أن هذه المجالات المطلوبة للغشاء المرفق. كان A-C محطة 111 بقايا atlastin-1 جزء يحتوي على المجالات عبر الغشاء توقع (بقايا 448-558) كافية لجمعية غشاء (الشكل 6 C).
لتقييم طوبولوجيا عبر الغشاء من البروتين atlastin-1، استخدمنا الحويصلات الميكروسومي سليمة من COS-7 خلايا overexpressing atlastin-1 في مقايسة حماية البروتيني (الشكل 7 A). فقد مناعية لكلا N و C تيرميني على علاج microsomes ل مع بروتين K، على الرغم من أن تركيزات أعلى هناك حاجة لإزالة كاملة للنطاق N-محطة (الشكل 7 A). وتشير هذه النتائج التي يتعرض لها كل من N و C تيرميني لمواجهة حشوية من الغشاء. في تجارب السيطرة، كان calregulin البروتين اللمعية محمية تماما من التحلل البروتيني في نفس العينات (الشكل 7 A)، حتى بتركيزات أعلى من الأنزيم البروتيني (لا تظهر البيانات). وتمشيا مع هذا الاستنتاج هو أن تحور المواقع إجماع الثلاثة لN -linked بالغليكوزيل في atlastin-1 (N177Q، N236Q، وN436Q) لم يغير هجرة atlastin-1 على SDS-PAGE، ولم المعاملة مع الببتيد N - غليكوزيداز F (الشكل 7 B). في تجارب السيطرة، وبروتين سكري يعرف torsin ألف (26، 27) overexpressed في COS-7 خلايا وdeglycosylated بكفاءة عن طريق الببتيد N -glycosidase F (الشكل 7 B). وبالتالي، ليس لدينا أي دليل على أن هذه المواقع إجماع في atlastin-1 وN -glycosylated في الجسم الحي، بما يتفق مع دينا نموذج مقترح الغشاء طوبولوجيا (الشكل 7 C).
http://www.jbc.org/content/278/49/49063/F7.small.gif
F IG. 7.
الغشاء طوبولوجيا atlastin-1. A، المقايسات حماية البروتيني. تركيزات المشار إليها (في ميكروغرام / مل) من بروتين K (بروت K أضيفت) لmicrosomes ل سليمة أعدت من COS-7 خلايا overexpressing غير محدد atlastin-1. تم immunoblotted العينات مع الأجسام المضادة ضد N (رقم 5409) أو C (رقم 4735) محطة من atlastin-1 أو مع أضداد calregulin. هاجر سليمة atlastin-1 في ~64 كيلو دالتون، وcalregulin سليمة (Calreg) في ~60 كيلو دالتون. سهام دلالة منتجات الهضم الجزئي. يشار إلى مناصب هجرة معايير الكتلة الجزيئية (في kilodaltons). B، لا atlastin-1 N -glycosylated. مقتطفات من COS-7 الخلايا معربا عن torsin A-Myc على أو Myc على الموسومة البرية من نوع atlastin-1 أو atlastin-1 مع الطفرات في المواقع إجماع الثلاثة لN -linked بالغليكوزيل (N177Q، N263Q، وN436Q؛ Glycos موت) وحضنت مع الببتيد N -glycosidase F (PNGase F) كما هو مبين وimmunoblotted مع الأجسام المضادة لمكافحة Myc على. لا الطفرات ولا الببتيد N -glycosidase F العلاج غيرت هجرة atlastin-1 من قبل SDS-PAGE. Torsin A-Myc على، وهو بروتين سكري معروف، وdeglycosylated التي كتبها الببتيد N -glycosidase F في ظل نفس الظروف. C، الهيكل التخطيطي المقترح atlastin-1 الغشاء طوبولوجيا.

Atlastin-1 هو بلازميدة قليلة القسيمات بروتين أعضاء dynamin / MX / GBP شكل الأسرة المجمعات البروتين وطي بلازميدة قليلة القسيمات في الجسم الحي، وسعينا لتحديد ما إذا atlastin-1 أشكال oligomers كذلك. باستخدام الخميرة الاختبارين الهجين، اكتشفنا التفاعل القوي من كامل طول atlastin-1 مع نفسه (الشكل 8 A). كنا قادرين على تضييق المجالات المطلوبة للتفاعل الذاتي من قبل يحلل الحذف. وقد انخفض التفاعلات أو القضاء عليها مع كل من N- والحذف-C محطة (الشكل 8 A). أيضا، لم نجد رابطة بين المجالات بين عدة N- مختلفة وC-الطرفية يبني المجال (الشكل 8 A)، على الرغم من بين المجالات وضمجزيئي التفاعلات أثبتت للأعضاء الآخرين من dynamin / MX / GBP الفصيلة (12، 28 - 31). في التجارب المشتركة مناعي، تفاعلت Myc على-atlastin-1 مع HA-atlastin-1 (الشكل 8 B)، مما يدل على الارتباط الذاتي من atlastin-1 overexpressed في COS-7 الخلايا. وبناء على نتائج التجارب عبر ربط الكيميائية، ويبدو atlastin-1 الأكثر احتمالا أن يكون homotetramer، مع المنتجات في ~110، ~160، و~230 كيلو دالتون بالإضافة إلى الفرقة مونومر في 64 كيلو دالتون (الشكل 8 C) . باستخدام هلام استبعاد FPLC، وجدنا أن المنظفات solubilized atlastin-1 مزال في حجم الأصلي لل~280 كيلو دالتون، بما يتفق مع هيكل رباعي القسيمات المقترحة (الشكل 8 D). ومع ذلك، لأن عبر ربط atlastin-1 المنتج في ~230 كيلو دالتون كان مرئيا ضعيفة، وكان من الصعب تقدير مساهمة المنظفات لتقديرات لحجم قليل وحدات atlastin-1 من قبل هلام الاستبعاد اللوني، ونحن لا يمكن أن يستبعد هيكل رباعي مثلوثي للبروتين atlastin-1 في الجسم الحي. ومن المثير للاهتمام، هاجر atlastin-1- (1-516)، الذي يحتوي على المجالات عبر الغشاء المفترضة أيضا في حجم الأصلي مماثل على هلام الاستبعاد اللوني. ومع ذلك، مزال atlastin-1- (1-447)، الذي يفتقر إلى المجالات عبر الغشاء، كما قمم متعددة (الشكل 8 D)، مما يدل على أن اثنين توقع يطلب من المجالات عبر الغشاء لالتشكل السليم و / أو oligomerization من atlastin-1.
http://www.jbc.org/content/278/49/49063/F8.small.gif
F IG. 8.
أشكال 1 Atlastin-وطي oligomers. مصفوفة من الخميرة المقايسات يومين الهجينة تظهر تفاعلات مختلف atlastin-1 (AT) N- وبنيات الحذف C-المحطة. يشار إلى حدود بقايا الأحماض الأمينية. وكان يعاير قوة التفاعل من قبل HIS3 وβ غالاكتوزيداز الاستقراء كما وصفها بلاكستون وآخرون. (20). في جميع الحالات، HIS3 وβ غالاكتوزيداز تحريض المترابطة. B، وشارك في مناعي من Myc- وHA الموسومة atlastin-1 البروتينات. و transfected الخلايا COS-7 مع أشارت atlastin-1 بنيات وimmunoprecipitated (IP) مع مكافحة HA الأجسام المضادة التحقيق. ثم تم immunoblotted رواسب مع الأجسام المضادة لمكافحة Myc على. الإدخال يمثل 20٪ من المواد الاساسية. C والكيميائية عبر ربط. وعولج مقتطفات من الخلايا COS-7-overexpressing Myc على atlastin-1 مع تركيزات أشار من dithiobis (succinimidyl بروبيونات) (DSP)، تعرض لSDS-PAGE باستخدام المواد الهلامية امختزل، وimmunoblotted مع الأجسام المضادة لمكافحة Myc على. يتم تحديد ثلاثة منتجات الدرجة الأعلى (السهام 2-4)، بالإضافة إلى مونومر (السهم 1). D، هلام استبعاد FPLC. تم immunoblotted aliquots من كل جزء مع الأجسام المضادة لمكافحة Myc على. وأظهرت حجم وشطف قمم الفراغ للبروتينات علامة (في kilodaltons) في أعلى. يشار إلى أرقام جزء على طول الجزء السفلي. على الرغم من Myc على-atlastin-1- (1-558) وMyc على-atlastin-1- (1-516) coeluted في ذروة جزء واحد، وكان Myc على-atlastin-1- (1-447) نمط شطف أوسع.

Atlastin-1 هو GTPase- عن طريق تنقية البروتينات CBP-atlastin-1 الانصهار، درسنا ما إذا atlastin-1 تمتلك النشاط GTPase. كميات متزايدة من atlastin-1 البروتين زاد تباعا نسبة GTP المائي (الشكل 9). وهكذا، atlastin-1 يرتبط ليس فقط GTP، كما هو مبين في الدراسات السابقة (32)، ولكن أيضا يعمل بمثابة GTPase (الشكل 9).
http://www.jbc.org/content/278/49/49063/F9.small.gif
F IG. 9.
Atlastin-1 هو GTPase. وحات العليا، تنقية CBP-atlastin-1 انصهار بروتين (1،1-4،4 μ م، كما هو مبين) أو ألبومين المصل البقري (السيطرة) وحضنت مع [α- 32 P] GTP ل0-60 دقيقة . [32 P] الناتج المحلي الإجمالي و[32 تم حلها P] GTP من قبل الانفصال على لوحات TLC. اللوحة السفلى، [32 ف] الناتج المحلي الإجمالي و[32 وتم قياس كمية P] GTP، وتم احتساب النسبة المئوية للGTP المائي كما هو موضح تحت عنوان "الإجراءات التجريبية ".

نقاش

الطفرات في SPG3A الجين يسبب الاصابة المبكرة جدا النقي HSP (2 - 5). في هذه الدراسة، وجدنا أن SPG3A منتج الجين atlastin-1 هو GTPase بلازميدة قليلة القسيمات تتألف من وحدات فرعية التي هي بروتينات الغشاء لا يتجزأ، مع كل من C و N تيرميني يتعرض إلى السيتوبلازم. حددنا أيضا عضوين آخرين من الأسرة atlastin من GTPases التي تشترك تشابه تسلسل كبير مع atlastin-1 وعلى الأرجح نفس السمات الهيكلية: atlastin-2 وatlastin-3 (الشكل 1). هذه البروتينات هي مشابهة من حيث الحجم ولها نفس الحفظ جدا الزخارف ملزم GTP فضلا عن توقع اثنين من المجالات عبر الغشاء. ومن المثير للاهتمام، وخرائط atlastin-3 الجين إلى منطقة داخل SPG17 (متلازمة فضة، MIM 270685) موضع (33)، وبالتالي قد يكون الجين مرشح لSPG17. الجين atlastin-2 في محيط SPG4 spastin الجينات على الكروموسوم 2.
هيكل الغشاء نقترح لatlastin-1 (الشكل 7 C) ليست نموذجية من جيجابايت في الثانية، والأسرة من GTPases الكبيرة التي وatlastins هي الأكثر مثلي (11، 12، 30). ومع ذلك، على الرغم من أن atlastins وجيجابايت في الثانية كل حصة حلقة RD بدلا من (N / T) K X D في عزر الثالث ضمن الكلاسيكية ملزم guanylate ثالوث، وهناك العديد من الاختلافات البنيوية بين atlastin والأسر GBP (12، 13، 32). أولا، على عكس atlastins، جيجابت في الثانية لديها محطة C-α حلزونية مجال إضافية أن تطوي إلى التفاعل مع المزيد من المناطق القريبة (12). ثانيا، الكثير جيجابت في الثانية لديها C-C محطة AAX (حيث A يمثل الأحماض الأمينية الأليفاتية) عزر لisoprenylation، وكلها من atlastins تفتقر (الشكل 1). ثالثا، لقد أظهرت دراستنا أن atlastin-1، ومن المرجح atlastin-2 وatlastin-3 هي البروتينات الغشاء لا يتجزأ مع اثنين من المجالات عبر الغشاء المفترضة. على النقيض من ذلك، جيجابت في الثانية ليست بروتينات الغشاء لا يتجزأ. في هذا الصدد، وatlastins أكثر تذكرنا FZO / mitofusins، GTPases الكبيرة التي تمتد غشاء الميتوكوندريا الخارجي مرتين، مع كل من N و C تيرميني التي تواجه السيتوبلازم (34، 35). لأن FZO / mitofusins ​​تعتبر بالغة الأهمية لالانصهار الميتوكوندريا السليم، قد يكون atlastin-1 أيضا دورا في الأحداث الانصهار هومو أو غيروي. وأخيرا، مثل العديد من dynamin / MX / GBP الفصيلة (أعضاء 12، 30، 31، 36)، atlastin-1-أشكال وطي oligomers. على الرغم من أن دراستنا تشير إلى أن atlastin-1 على الأرجح تجمع باعتباره homotetramer، فإنه ليس من الواضح ما إذا كان يمكن أن تشكل أيضا مجمعات مغايرة التغصن مع atlastin-2 وatlastin-3. ومن غير الواضح أيضا ما إذا كان atlastins تكون قادرة على تشكيل هياكل النظام أعلى، كما تبين لأعضاء آخرين في dynamin / MX / GBP الفصيلة (12، 31، 36).
على الرغم من وظائف البروتينات atlastin غير معروفة، وقد حددت عدة مجموعات البروتينات التفاعل atlastin بواسطة الخميرة فحص اثنين من الهجين (32، 37). وقد تبين Atlastin-1 / GBP3 البشري إلى التفاعل مع الإنسان NIK / HGK، التي تعد واحدة من المجموعة الأولى جرثومي تحركات مركز، مجموعة من MAPK تحركات كيناز كيناز الذي ينشط شلال SAPK / JNK في مجموعة متنوعة من أنواع الخلايا (32 ). التفاعل مع atlastin-1 يحدث عن طريق يسين الغنية CHN مجال NIK / HGK. تظهر بقايا 1-129 من atlastin-1 أن تكون كافية للتفاعل (32). وقد تبين Atlastin-2 / ARL-6-التفاعل البروتين 2 للتفاعل مع ARL-6، وA DP- ص ibosylation factor- ل آيك البروتين الذي هو في الغالب عصاري خلوي، ولكن الزميلة مع الأغشية ردا على GTPγS (37). الثالث-C النهائي للatlastin-2 (بما في ذلك اثنين من المجالات عبر الغشاء المقترحة) كافية لهذا التفاعل. ومن المثير للاهتمام، العديد من العوامل ADP-ribosylation وADP-ribosylation عامل مثل البروتينات مهمة لتجنيد البروتينات مثل golgins وCOPI إلى جهاز جولجي (38، 39). الآثار الوظيفية لهذه التفاعلات التي تم تحديدها atlastin البروتين غير معروفة، ولكن.
كيف الطفرات في الجين atlastin-1 تغير البروتين atlastin-1؟ لكن كل واحد من التقارير atlastin-1 الطفرات في المرضى الذين يعانون من SPG3A تمثل الطفرات مغلطة. والآخر هو الإدراج النوكليوتيدات مما أدى إلى الإنهاء المبكر في المجال محطة C (13 - 16). طفرة مغلطة واحد (R217Q) تغير بقايا الحفظ جدا في حلقة RD داخل جيب ملزم GTP من atlastin-1، وبالتالي قد يغير GTP ملزمة أو النشاط GTPase (14). على الرغم من أن الطفرات مغلطة أخرى تحدث في بقايا الحفظ جدا بين الأسرة atlastin، آثارها لا تزال غير واضحة. ومن المثير للاهتمام، وتقع هذه الطفرات في كل N- والمناطق C-الطرفية، مما يشير إلى أن التغيرات الطفيفة حتى في التسلسل الأساسي في مناطق مختلفة متعددة قد تكون لها آثار هيكلية أو وظيفية عميقة. يمكن لهذه التغيرات تسلسل يحتمل أن تتداخل مع oligomerization وتكوين الجمعيات غشاء المناسبة، توطين الخلوية، والنشاط GTPase، وتفاعلات atlastin-1 مع بروتينات أخرى.
البروتين atlastin-1 هو الأكثر وفرة في الدماغ، على الرغم من أنه موجود أيضا في مستويات أقل من ذلك بكثير في الأنسجة الأخرى، بما في ذلك الرئة، العضلات الملساء، الغدة الكظرية والكلى، والخصية. داخل الدماغ، وأثرى atlastin-1 بارز في الصفيحة V الخلايا العصبية الهرمية في قشرة الدماغ، جزء من السكان من التي تظهر على axonopathy البعيدة في المرضى الذين يعانون من SPG3A. هذه الخلايا العصبية الحركية العليا مشروع لخفض الخلايا العصبية الحركية في النخاع الشوكي القطني، والنتائج خلل في وخزل سفلي تشنجي، ميزة الكاردينال شركائنا HSPs. لأن هذه الخلايا العصبية لها بين أطول المحاور في النظام العصبي المركزي، واختلال وظيفي في المرضى SPG3A قد يعكس دورا حاسما في المناسبة atlastin-1 وظيفة في هذه الفئة من القطعان من "محور عصبي طويل" الخلايا العصبية الحركية العليا. بناء على توطين التحت خلوية من atlastin-1 إلى جهاز جولجي والتشابه الهيكلي لأعضاء dynamin / MX / GBP الفصيلة من GTPases، قد يكون atlastin-1 المهم لديناميات غشاء جولجي المناسبة أو الاتجار حويصلة.
كيف يمكن المعيبة جولجي هيكل الغشاء أو الاتجار حويصلة يسبب axonopathy البعيدة في الخلايا العصبية الحركية العليا مع محاور عصبية طويلة؟ النقل عيب على طول المحاور التي تورطت مباشرة في عدد من axonopathies طويلة وراثي، بما في ذلك HSP SPG10 (طفرات في كينيسين KIF5A العصبية) (8) والاعتلال العصبي وراثي شاركو ماري توث نوع 2A (طفرات في بروتين السيارات KIF1Bβ) (40)، وكذلك في شكل جسمية مهيمنة انخفاض مرض العصبون الحركي (طفرات في P150 فرعية من dynactin) (41). على الرغم من أن هذه البروتينات الحركية تؤثر بشكل مباشر على النقل، تشكيل السليم للبضائع داخل الخلايا مهم كذلك. ونظرا للوقت مبكر من بداية SPG3A والاقتراحات التي قد يكون بسبب تشوهات للتنمية الخلايا العصبية (3، 4)، فمن المثير للاهتمام أن علاج الخلايا العصبية قرن آمون مع brefeldin A، المستقلب الفطرية أن يعطل جهاز جولجي، ويحول دون نمو محور عصبي (42 ). وبالتالي، مطلوب جهاز جولجي سليمة للنمو محور عصبي (42)، والتي قد تكون ذات أهمية خاصة لتشكيل محور عصبي طويل خلال تطوير النظام العصبي المركزي. تصور، قد الطفرات من atlastin-1 في المرضى الذين يعانون من وظيفة SPG3A يؤدي إلى هيكل جولجي أو ضعف وظائف، مما يؤدي إلى نمو محور عصبي ضعف. الدراسات المستقبلية من آثار الطفرات المريض SPG3A على هيكل جولجي وظيفة وكذلك نقل محور عصبي والنمو قد توضح المرضية الخلوية من HSP SPG3A

رافت ابراهيم 11-22-2015 09:14 PM

دراسة سريرية والجينية والبيوكيميائية من الطفرات spg7 في الشلل النصفي التشنجي وراثي
 
http://brain.oxfordjournals.org/content/127/5/973.full


الملخص

الطفرات في الجين SPG7، ترميز البروتين paraplegin الميتوكوندريا، وكان أول من ذكر اسمه في راثي متنحي الشلل النصفي التشنجي وراثي (ARHSP). وقد وصفت أربع طفرات SPG7 مختلفة حتى الآن بالتعاون مع كل نقية ومعقدة الظواهر HSP. وقد أظهرت الخزعات العضلية من المرضى الأكثر تضررا دليل النسيجي للعيب الفسفرة المؤكسدة. حددنا ست قبائل ARHSP، ومنهم من الربط SPG7 لا يمكن استبعاد، و 29 متقطع مرضى الشلل النصفي التشنجي. تم فحص والإكسونات 17 والمناطق المحيطة من الجين SPG7 للطفرات باستخدام مزيج من واحد الذين تقطعت بهم السبل تعدد الأشكال التشكل (SSCP) تحليل والتسلسل. تم العثور على ثلاثة مرضى لتنفيذ مجمع الطفرات SPG7 متخالف، تتألف من خمسة رواية واحدة الطفرة التي سبق وصفها. لم الخزعات العضلية من مريضين طفرة SPG7 لا تظهر أي دليل النسيجي للعيب الفسفرة المؤكسدة. ومع ذلك، كشفت التحاليل البيوكيميائية انخفاض في سترات لتصحيح سينسيز المجمع الأول ومجمع II الأنشطة / III في العضلات والنشاط I معقدة في الكسور التخصيب الميتوكوندريا من myoblasts مثقف، مما يدل على أن إما الابتدائي أو عيب الثانوي من سلسلة وظيفة الجهاز التنفسي قد تلعب دورا هاما في التسبب في المرض.
  • الشلل النصفي التشنجي راثي؛ paraplegin. SPG7
  • ARHSP = راثي متنحي الشلل النصفي التشنجي راثي؛ HSP = الشلل النصفي التشنجي راثي؛ SSCP = واحد الذين تقطعت بهم السبل تعدد الأشكال التشكل
مقدمة

الشلل النصفي التشنجي وراثي (HSP) يشمل مجموعة من الاضطرابات غير المتجانسة سريريا وراثيا التي الميزة الغالبة هي التشنج التدريجي وضعف في الأطراف السفلية. قد يكون وراثة وراثي جسمي، جسمي مقهور (ARHSP) أو X-ربط. يتم تصنيف النمط الظاهري كما النقي HSP عندما تقتصر أعراض وعلامات لتلك التي من خزل سفلي تشنجي التدريجي مع احتمال العمود الخلفي أو تورط المثانة (بولو وآخرون، 1993). وقد وصفت الظواهر HSP المعقدة بالتعاون مع مجموعة واسعة من المظاهر السريرية العصبية أو غيرها إضافية (ماكديرموت وشو، 2002).
في معظم الحالات HSP (~80٪) إثبات أدلة على ميراث السائد (بولو وآخرون، 1991). حتى الآن، تم تعيين 10 جسمية مواضع HSP المهيمنة، والتي من الطفرات في خمسة جينات، SPG3A (atlastin)، SPG4 (spastin)، SPG6 (NIPA1)، SPG10 (KIF5A) وSPG13 (Hsp60)، وقد تم تحديد (حزان وآخرون آخرون، 1999.؛ تشاو وآخرون، 2001.؛ هانسن وآخرون، 2002.؛. ريد وآخرون، 2002؛. رينييه وآخرون، 2003). يبدو الميراث مقهورة مناطق خارج شائعة نسبيا حيث توجد معدلات عالية من زواج الأقارب (Sridharan وآخرون، 1985)، على الرغم من أنها قد يشكلون نسبة كبيرة من الحالات فيما يبدو متفرقة. حتى الآن، وقد تم تحديد ستة مواضع ARHSP والطفرات المسببة العثور عليها في اثنين من الجينات، SPG7، الترميز paraplegin، وSPG20، ترميز spartin البروتين (. Casari وآخرون، 1998؛. باتل وآخرون، 2002).
كان SPG7 أول جسمية HSP الجينات تتسم. تقع على الصبغي 16، ويضم 17 الإكسونات تمتد ~52 كيلوبايت. المنتج البروتين، paraplegin، ويتكون من 795 الأحماض الأمينية ويموضع إلى الميتوكوندريا. وتشترك في أقرب الأحماض الأمينية تسلسل تناظر مع الخميرة metalloproteases الميتوكوندريا Afg3، Rca1 وYme1 (Casari وآخرون، 1998.؛ Settasatian وآخرون، 1999.). هذه البروتينات هي أعضاء الفصيلة البروتين AAA (أتباز المرتبطة بالأنشطة الخلوية المتنوعة) التي توجد على نطاق واسع في كل من خلايا أولية النواة وحقيقية النواة وتلعب دورا هاما في مجموعة متنوعة من الأنشطة الخلوية بما في ذلك انقسام الخلايا، والنسخ، وعضية نشوء حيوي والنقل حويصلة و التجمع انزيم (باتل وLatterich، 1998). الخميرة ATPases الميتوكوندريا تمتلك كل من بروتين والأنشطة مثل كوصي على الغشاء الداخلي الميتوكوندريا حيث كانوا يشاركون في التجمع وتدهور البروتينات في سلسلة معقدة التنفسي (بيرس، 1999). طفرة من هذه الجينات في الخميرة يستحث سلسلة عيب في الجهاز التنفسي بسبب كتلة في البرلمان من مفارز في الانزيمات وظيفية (بول وTzagoloff، 1995). وفي وقت لاحق، عددا من الجينات البشرية إضافية ترميز البروتينات عالية مثلي لparaplegin مثل تم اكتشافها AFG3L1، AFG3L2 وYME1L1 (بانفي وآخرون، 1999.؛. كوبولا وآخرون، 2000؛. Kremmidiotis وآخرون، 2001). وتظل الوظيفة الدقيقة للparaplegin والبروتينات ذات الصلة في البشر غير مؤكدة.
حتى الآن، وقد وصفت أربعة SPG7 الطفرات الناتجة في أي نقية أو معقدة الظواهر HSP. بعد الربط 16q24.3 في أسرة إيطالية الأقارب كبيرة مع النمط الظاهري معقد متغير (دي ميشيل وآخرون، 1998)، Casari وآخرون. (1998) اكتشف الحذف 9.5 كيلوبايت المقابلة لالإكسونات الخمس الماضية من الجين SPG7. وكشف تحليل خزعة العضلات من شخصين تضررا التغييرات المميزة من الميتوكوندريا العيوب الفسفرة المؤكسدة بما في ذلك ألياف خشنة الحمراء، السيتوكروم ج-أوكسيديز سلبي وسوسينات ألياف نازعة إيجابي. أكد المجهر الإلكتروني تراكم الميتوكوندريا غير طبيعية تحتوي على شوائب paracrystalline في 'موقف للسيارات' النمط. ومع ذلك، في اثنين من الأفراد المتضررين أقل بشدة، وشوهدت قليلة فقط، أوكسيديز السلبية المنتشرة السيتوكروم ج الألياف. اثنين من طفرات انزياح الإطار إضافية، حذف 2 سنة مضت في اكسون 6 في عائلة ايطالية صغيرة مع خالص HSP والإدراج قاعدة واحدة في اكسون 17 في HSP الفرنسي المشابهة مع النمط الظاهري تعقيدا بما في ذلك البصرية، وضمور القشرية والمخيخ، كما تم تحديد. وكانت كل من الأسر والأقارب متماثلة اللواقح بالنسبة للطفرة (Casari وآخرون، 1998). في الآونة الأخيرة، وقد تم الإبلاغ عن متخالف 9 الحذف غليان في اكسون 11 من SPG7 في أب وابنه تتأثر خزل سفلي تشنجي، مما يشير إلى احتمال النمط السائد وراثي جسمي من الميراث في هذه العائلة (ماكديرموت وآخرون، 2001).
وكان الهدف من هذه الدراسة هو فحص لفيف كبير من الحالات مقهورة HSP المتنحية ومتفرقة من المملكة المتحدة إلى تقدير مدى انتشار الطفرات SPG7 في هذه الفئة من السكان وزيادة تحديد طبيعة الخلل الميتوكوندريا في الأفراد المتضررين.

طرق

المواضيع

وتم تحديد عشرين قبيلة HSP أدلة على راثي الميراث المتنحية ومزيد من 29 مريضا بشكل متقطع وليس لهم تاريخ العائلة، ومنهم من الأسباب البديلة لشلل سفلي تشنجي استبعدت، إما من خلال قاعدة البيانات التي أنشئت من المرضى HSP البريطانية (التي يوجد مقرها في المراكز الثلاثة المشاركة الذين أجروا البحث في HSP لعدة سنوات) أو عن طريق وحدة البريطاني العصبية المراقبة، التي تنقل بانتظام مع جميع أطباء الأعصاب مستشار المملكة المتحدة يطلب فيها معلومات عن فئات محددة المريض. جميع الأفراد أعطى موافقة مستنيرة للمشاركة في الدراسة، التي حصلت على موافقة متعددة الإقليمية جنة أخلاقية.
التنميط الجيني والربط تحليل

تم استخراج DNA من الدم الجينوم بأكمله باستخدام البروتوكولات القياسية. تم التحقيق الربط موضع SPG7 في 20 عائلة ARHSP باستخدام متعددة الأشكال من الواسمات الوراثية D16S413، D16S3023 وD16S303. وكانت تضخيم تفاعل البلمرة المتسلسل (PCR) حجم المنتجات مجزأة من قبل الكهربائي باستخدام 8٪ المواد الهلامية بولي أكريلاميد وتصور من قبل تلطيخ الفضة. حسبت عشرات زوجيا اللد باستخدام MLINK في ظل افتراض الترددات أليل المتساوية والمساواة الذكور والإناث معدلات إعادة التركيب. كان يفترض أن تكون وراثة المرض باعتباره مقهورة مع انتفاذ كامل وتردد أليل من 10 -4.
الكشف عن الطفرات

وقد صممت ثمانية عشر زوجا من الاشعال، بناء على الصبغي 16 مشروع تسلسل البيانات، لتضخيم المنطقة الترميز والمرافقة تقاطعات لصق جميع الإكسونات 17 من الجينات SPG7. أجريت تقارير إتمام المشروعات (50 ميكرولتر) في ظل ظروف الأمثل (الجدول 1). واحد الذين تقطعت بهم السبل التشكل تعدد الأشكال تم تنفيذ (SSCP) التحليل باستخدام 0.6٪ والمواد الهلامية والكشف عن الطفرات تعزيز تشغيل في 4-10 درجة مئوية لمدة 10-16 ساعة لتحقيق الانفصال الأمثل للفروع. وتميزت التحولات التنقل عن طريق التسلسل المباشر لمنتجات PCR تنقيته باستخدام BIGDYE (النظم البيولوجية التطبيقية) وتحليلها على تحليل الوراثي ABI 3100.

الجدول 2
تردد من الأشكال SPG7 في المريض والسيطرة الكروموسومات
موقع تغيير النوكليوتيدات توقع تغيير البروتين الكروموسومات المرضى = 70) الكروموسومات التحكم (ن = 100) اكسون 1 120G → A G40G 1 1 إنترون 4 IVS4 + 12C → T - 36 56 إنترون 7 IVS7 + 5G → A - 2 3 إنترون 7 IVS7 + 17G → C - 2 2 إنترون 7 IVS7 + 38G → A - 3 5 إنترون 10 IVS10 + 19G → A - 2 5 اكسون 11 1507A → G T503A 2 6 اكسون 11 1529C → T A510V 1 4 إنترون 12 IVS12 + 13C → T - 1 4 إنترون 13 IVS13 + 45G → C - 14 31 اكسون 14 1816C → T G605G 0 1 اكسون 15 2063G → A R688Q 5 24 اكسون 17 2283G → A Q761Q 2 2 اكسون 17 2292C → T I764I 2 4
A = ألانين. G = الجلايسين. I = آيسولوسين؛ Q = الجلوتامين. R = أرجينين. T = ثريونين. V = حمض أميني أساسي.


الجدول 3
الطفرات SPG7 الكشف
صبور موقع تغيير النوكليوتيدات توقع تغيير البروتين 1 اكسون 1 28G → A A10S
اكسون 13 1729G → A G577S 2 اكسون 8 1057-1085del29 انزياح الإطار 353-384X385
اكسون 13 1715C → T A572V 3 اكسون 11 1450-1458del9 E، R، R484-486del
اكسون 15 2026T → C F676L
A = ألانين. E = حمض الجلوتاميك. F = الفينيل ألانين. G = الجلايسين. L = يسين. R = أرجينين. S = سيرين. V = حمض أميني أساسي.


الجدول 4
الخصائص السريرية للمرضى الذين يعانون من الطفرات SPG7
صبور 1 2 3 عمر (سنة) 21 51 42 جنس م F م العمر عند بداية (سنة) 11 14 19 التلفظ - + + الرأرأة تذبذب المقلتين السريع اللإرادي - + + ضعف المثانة - - + الطرف العلوي


الشلل التشنجي + + + ضعف - - - ترنح - + + فرط المنعكسات + + + حسي - - - الطرف السفلي


قدم جوفاء + + - الشلل التشنجي + + + ضعف - + + ترنح - + + فرط المنعكسات + + + حسي - + - ردود الفعل أخمصي ↑↑ ↑↑ ↑↑ مشية تشنجي تشنجي-رنحي تشنجي-رنحي الحالة الوظيفية مستقل يتطلب عصا مستقل EMG / NCS لم تفعل طبيعي طبيعي التصوير بالرنين المغناطيسي الدماغ طبيعي تلين hyperintensity T2. ضمور المخيخ ضمور المخيخ الحبل الشوكي التصوير بالرنين المغناطيسي طبيعي طبيعي طبيعي
M = ذكور؛ F = أنثى؛ + = الحاضر. - = غائبة. ↑↑ = ثنائيا الباسطة. دراسات NCS = التوصيل العصبي.


الجدول 5
الميتوكوندريا أنشطة مجمع السلسلة التنفسية تصحيح لسينسيز سيترات في المرضى الذين يعانون طفرة SPG7، غير مرضى SPG7 ARHSP والضوابط

مجمع I II معقدة / III مجمع IV عضلة


المريض 2 0،182 0.132 0.018 المريض 3 0،115 0.14 0.017 ضوابط 0.227 ± 0.037 0.217 ± 0.032 0.0196 ± 0.0043 عدم SPG7 ARHSP 0.185 ± 0.085 0.211 ± 0.116 0.171 ± 0.012 بالخلايا العضلية الجذعية


المريض 2 0.09 0.27 0.025 المريض 3 0،044 0.28 0.018 ضوابط 0.158 ± 0.046 0.288 ± 0.046 0.027 ± 0.011
± فاصل الثقة 95٪.


الجدول 1
الاشعال وشروط إتمام المشروعات SPG7
اكسون التمهيدي إلى الأمام التمهيدي العكسي الصلب temperatue (° C) ملي MgCl 2 PCR حجم المنتج (بي بي) 1 5 'ATCACGCAGGCGCGGCTTTCAG 3' 5 'CTGGGCCTTACAGAGCAGA 3' 60 15 270 2 5 'AGTCTGCATTGCTTTGGTACT 3' 5 'TAGCTGAGGCGATAAGTGTG 3' 57 15 228 3 5 'GGAGTACACTGTTGTCCTGT 3' 5 'ACAGAAATGTAAAGACATCCAG 3' 55 15 226 4 ا 5 'AAGCTCTGGATGTCGCCCGT 3' 5 'AGGAAATGCTGCCTCCGCTG 3' 57 15 193 4B 5 'GCGGTTGTCATGAGCCTCCT 3' 5 'CTCACTCTCACAGGCTGCCA 3' 57 2.0 241 5 5 'GACTGTAGGGTTGCTCGTCT 3' 5 'CAGATTACAAAGCCAAGTTAGG 3' 55 15 260 6 5 'TTGGAAGCCTGCGTCTGTCA 3' 5 'GTATTCAGCAAACACAAACCAG 3' 57 15 225 7 5 'CTGGCATCGTGCTGCTGATT 3' 5 'CCCTTCTGGGAGAGGAGGA 3' 57 15 257 8 5 'AGTGTTGCATTGTCTGCTGC 3' 5 'ATGTGTGAAAGGAGCCAGGT 3' 57 2.0 252 9A 5 'CCTTGGTGTAGAACTTTGTCT 3' 5 'TGTTGGAGAAGCCGGACATG 3' 55 15 221 9B 5 'GCATCGTCTACATCGATGAG 3' 5 'CCTGTTCTGAAAGACATCGG 3' 55 15 187 10 5 'TCCCTCCTGTGTCCTGAAGG3 " 5 'CCAGACCACTCAGAGCGAGT 3' 57 15 283 11 5 'ACCTGTGGCAGTAACTAGGT 3' 5 'GCCTTGATGCTGTTTGCGCA 3' 57 15 211 12 5 'CTCTTAAGCCCTGATAGCAG 3' 5 'TCACCTCTCAATACCTGCCT 3' 55 2.0 252 13 5 'GTCTCGAACTCCTGTCCTCA 3' 5 'AGTCAGCTACAGACACAGGC 3' 60 15 300 14 5 'ACGGAGACCTCTTAGTCCCA 3' 5 'CATGGCATGCACTGGAACAG 3' 55 2.0 321 15 5 'ACTGCTCTGCGCCTGCAGT 3' 5 'CCTTGTGTGGTAGACCCA 3' 57 15 294 16 5 'TCTGTGCTTTGGTGCTGGAG 3' 5 'ACCGTGGGTGCTGTGTGGA 3' 57 15 206 17 5 'ACATGCATATGCCTGTTCTTT 3' 5 'CTCAGCTGAAAAGCAACTCAG 3' 55 15 312
تحليل خزعة العضلات

أجريت الخزعات العضلية مفتوحة تحت مخدر موضعي من الوحشية المتسعة في اثنين من المرضى الذين يعانون من الطفرات SPG7. تم تحليل العضلات لردود الفعل النسيجية القياسية بما في ذلك متتابعة السيتوكروم أوكسيديز وردود الفعل نازعة سكسينات. عينات العضلات من كل من المرضى، وأعدت أيضا أربعة مرضى إضافية مع ARHSP ومنهم من الربط SPG7 قد استبعدت و19 العمر كعينة ضابطة ويعاير لالميتوكوندريا I معقدة، II / III، IV وسينسيز سترات كما هو موضح سابقا (شابيرا وآخرون .، 1990). تم تصحيح أنشطة سينسيز سترات والبروتين (Biorad)، وذلك باستخدام ألبومين المصل البقري كمعيار قياسي. وقد تم قياس السلسلة التنفسية النشاط المعقد أيضا في شظايا الميتوكوندريا المعزولة من myoblasts مثقف بواسطة الطرد المركزي التفاضلي من كل من المرضى وتسعة في العمر كعينة ضابطة.

النتائج

التنميط الجيني والربط تحليل

تم استبعاد الربط موضع SPG7 في 14 من 20 ARHSP قبيلة (لا تظهر البيانات). لم يستبعد ست عائلات المتبقية نظرا لحجم نسب صغيرة أو علامات uninformative. لذا تم فحص واحد الفرد المصاب من كل من هذه العائلات إلى جانب متفرقة الحالات الشلل النصفي التشنجي 29 للطفرات SPG7.
الكشف عن الطفرات

بعد تحليل SSCP الأولي وتسلسل كل التحولات التنقل، تم تحديد ما مجموعه 12 التغييرات تسلسل متخالف في المناطق ترميز الجين SPG7. أربعة تم الإبلاغ سابقا الأشكال. ثلاثة تغييرات تسلسل الأخرى المحفوظة، 120G → A (G40G)، وقد تم تحديد 1816C → T (G605G) و2283G → A (Q761Q)، وأيضا في عينات مراقبة، وتحديد لهم كما الأشكال الجديدة. لم تحديد خمسة تغييرات تسلسل الترميز المتبقية في 200 الكروموسومات السيطرة، ودعم هذه الطفرات المسببة للأمراض كما. وقد تم تحديد وسبعة الأشكال intronic إضافية أيضا في عينات المريض والسيطرة عليها. ويرد موجز من الأشكال SPG7 والترددات النسبية في المريض والسيطرة الكروموسومات في الجدول 2.
في المجموع، تم تحديد ستة SPG7 الطفرات، خمسة منها رواية (الجدول 3). وكان اثنان من المرضى (1 و 2) الزيجوت المركبة، كل من لديه اثنين من الطفرات المختلفة. المريض 1 زيارتها لديهم تاريخ عائلي موحية من الميراث مقهورة، ولكن كان المريض 2 متفرقة. مريض مزيد متفرقة (3) ظهرت في البداية على تحمل سوى طفرة متخالف واحدة، وحذف 9 غليان في اكسون 11 (1450-1458del9) التي سبق ارتبط الممكن راثي الميراث المهيمن. التسلسل المباشر لجميع الإكسونات المتبقية في هذا المريض كشف التغيير الثاني في تسلسل اكسون 15، 2026C → T (F676L)، التي لم تنتج تحولا التنقل مرئية على SSCP تحت أي ظرف من الظروف اختبارها. وبالتالي زوج جديد من الاشعال تحتوي على تغيير تسلسل في قاعدة الأولى من التمهيدي العكسي تصميم، وPCR في ظل الظروف الأمثل تضخيم بنجاح DNA المريض ولكن أيا من 100 عينة السيطرة، ودعم هذا النحو الطفرة الثانية في هذا المريض.
الخصائص السريرية للمرضى الذين يعانون من الطفرات SPG7

ارتبطت طفرات SPG7 مع الظواهر HSP معقدة بنسب مختلفة في جميع المرضى الثلاثة (الجدول 4). عمر البدء يتراوح 11-19 عاما، مع التدهور التدريجي ببطء. كل ذلك أظهر زيادة لهجة في جميع أطرافه الأربعة، أكثر وضوحا في الساقين، مع قوة الحفاظ نسبيا. وكان المرضى 2 و 3 على حد سواء مثلت علامات المخيخ، مع أطرافهم وترنح، والتلفظ ورأرأة. ولم يكن لدى أي من المرضى ضمور العصب البصري.
وأظهرت مسح الدماغ بالرنين المغناطيسي في المرضى الذين يعانون 2 و 3، الذي كان وترنح، وضمور المخيخ (الشكل 1). ولوحظت مجالين صغيرة من الآفات عالية إشارة T2 حول البطينات الدماغية من أهمية مؤكدة أيضا في المرضى 2. المظاهر MRI من الحبل الشوكي والطبيعي في جميع المرضى الثلاثة. EMG، كانت طبيعية أيضا دراسات التوصيل العصبي والاستجابات البصرية أثار في المرضى الذين يعانون 2 و 3.

تين. 1 محوري T2 التصوير بالرنين المغناطيسي في المرضى 3 تظهر ضمور المخيخ.

كان كلا الوالدين من المريض 3 على الفحص العصبي الطبيعي كجزء من هذه الدراسة. وكان المريض 1 نتاج زواج ابن عم الأول، وكان أربعة أشقاء وشقيقة واحدة. التاريخ، كما قد تأثرت أخ واحد. ومع ذلك، كانت لا أفراد العائلة الأخرى المتاحة للفحص، على الرغم من أن الآباء قد سبق فحص وشعروا أن تكون طبيعية. كان والدي المريض 2 كما لا تتوفر (توفيت والدته، ورفض الأب أن تشارك)، ولكن لم يكن لأيهما تشوهات عصبية أو المشية قبل التاريخ.
تحليل خزعة العضلات

خزعات العضلات من المرضى 2 و 3 أظهر كلا من التغيرات من إزالة التعصيب مع عودة التعصيب محدودة. في كل حالة، أظهرت الألياف الكتابة فائض ملحوظ من النوع 1 الألياف مع العديد صغير، ضامر، والألياف مزوى، في الغالب من النوع الثاني. واعتبرت أي ألياف خشنة الحمراء، ورغم وجود عدد قليل من متناثرة السيتوكروم ج-أوكسيديز سلبي الألياف في جميع أنحاء الخزعات والبقع أكسدة، بما في ذلك سكسينات نازعة، واعتبرت ضمن الحدود الطبيعية بالنسبة لعمر في المرضى.
ويظهر تحليل الميتوكوندريا وظيفة السلسلة التنفسية في العضلات من المرضى 2 و 3 في الشكل 2. مقارنة مع الضوابط، وأنشطة لتصحيح سينسيز سيترات لأني معقدة ومعقدة II / III انخفض تحت نطاق السيطرة يعني في كل من المرضى، في حين أن النشاط الرابع معقد يبدو الحفاظ نسبيا (الشكل 2 A). وكانت صورة مماثلة واضحة عندما تمت مقارنة اثنين SPG7 المرضى طفرة مع المرضى ARHSP الآخرين ومنهم من الربط SPG7 قد استبعدت، مع أنني معقدة ومعقدة II / III الأنشطة التي تقع تحت يعني الضوابط. ولكن نظرا لصغر حجم العينة في هذه المجموعة، وكانت فترات الثقة لأنشطة مكافحة يعني كبيرة والاختلافات غير الجوهرية (الجدول 5). كما أظهر الجهاز التنفسي المقايسات وظيفة سلسلة حول الكسور الميتوكوندريا المعزولة من myoblasts مثقف في كل من المرضى طفرة SPG7 انخفاض في سترات لتصحيح سينسيز الأنشطة المعقدة أنا خارج الخطأ القياسي لأسعار السيطرة متوسط، على الرغم من / الأنشطة المعقدة II III ومجمع IV كانت في وضعها الطبيعي مجموعة (الشكل 2 B).

تين. 2 التنفسي سلسلة النشاط المعقد تصحيح لسينسيز سترات. يتم التعبير عن بيانات التحكم كما يعني فاصل الثقة ± 95٪. أعرب النشاط الرابع معقدة × 10. (A) في العضلات المتجانسة. (B) بالخلايا العضلية الجذعية الكسور الميتوكوندريا.

نقاش

منذ اكتشاف SPG7 كما الجين الأول المسؤول عن ARHSP، تم الإبلاغ عن الطفرات أربعة فقط. ثلاثة وقعت في الأنساب الأقارب تمتلك طفرات متماثل، في حين تم العثور على معظم ذكرت مؤخرا متخالف 9 الحذف غليان في اكسون 11 (1450-1458del9) في الأب وابنه من عائلة والذي اقترح الممكن راثي الميراث المهيمن. حددنا ستة SPG7 الطفرات، في حالة واحدة من عائلة مع الممكن راثي الميراث المتنحية، وحالتين HSP يبدو متفرقة. كانوا جميعا الزيجوت المركبة لمدة طفرات منفصلة. هذا أمر غير مألوف بالنسبة للمريض 1 الذي كان نتاج الآباء الأقارب. ولوحظ وجود النمط الظاهري مماثلا مع رنح مخيخي بارز في الحالتين متفرقة. وقد تم تحديد الطفرات في أي من ستة راثي المرضى HSP المتنحية من الأسر ومنهم من الربط إلى مكان SPG7 لا يمكن استبعاده.
الشكل 3 يبين توزيع الطفرات في SPG7. الطفرات مغلطة اثنين في المريض 1 تحدث في مجالات وظيفية الحفظ للغاية. طفرة A10S في اكسون 1 نتيجة في الاستعاضة عن مسعور مع بقايا الأحماض الأمينية ماء في الببتيد زعيم paraplegin. وتحتاج هذه قصيرة تسلسل الأحماض الأمينية في N-محطة للبروتينات الميتوكوندريا المشفرة النووية لتشكيل الأساسي، الحلزون متقابلة الزمر من أجل السماح استهداف البروتين على الميتوكوندريا (يثغو، 2000). لذا من المتوقع إدخال ماء بقايا الأحماض الأمينية في الببتيد زعيم لعرقلة توطين الميتوكوندريا من paraplegin. الطفرة الثانية، G577S، ويقع ضمن الحفاظ ملزم الزنك عزر (HESGH)، وتوفير مزيد من الأدلة لأهمية وظيفية لهذا المجال في paraplegin.

تين. 3 التمثيل التخطيطي للجين SPG7 تبين المجالات والمواقع من الطفرات وظيفية.

في المريض 2، وطفرة مغلطة في اكسون 13 (A572V) النتائج في استبدال حمض أميني اثنين من مخلفات قبل المجال ملزم الزنك. على الرغم من أن كلاهما غير القطبية، والأحماض الأمينية مسعور صغيرة، ووضع نماذج من البروتين متحولة مع برنامج التنبؤ GOR4 (http://npsa-pbil.ibcp.fr/cgi-bin/secpred_gor4.pl أظهرت) التشكل المتغيرة في المنطقة المجال ملزم الزنك من نمط لفائف α-الحلزون α حلزون عشوائي إلى حبلا الموسعة. هذا تغيير في هيكل الثانوي من المرجح أن يعطل النشاط الوظيفي لهذا المجال. الطفرة الثانية في المريض 2، حذف 29 نقطة أساس في اكسون 8 (1057-1085del29)، هي ضمن كاسيت AAA التي تنطوي على جزء من عزر ATP ملزم الحفظ جدا. فإنه يؤدي إلى انزياح الإطار مع كودون وقف سابق لأوانه في بقايا 385، وتوقع أن تسفر عن بروتين اقتطاع.
في المريض 3، وكانت طفرة واحدة حذف 9 غليان في اكسون 11 (1450-1458del9) ذكرت سابقا طفرة المهيمنة الممكن راثي (ماكديرموت وآخرون، 2001). هذا هو داخل الكاسيت AAA، مما أدى إلى فقدان ثلاثة أحماض أمينية (E، R، R484-486del). فشل تحليل SSCP أيضا لتحديد طفرة ثانية في مريضنا، وكان فقط عن طريق التسلسل المباشر لالإكسونات المتبقية التي تغير تسلسل آخر، 2026C → T (F676L)، تم الكشف. الفحص العصبي للوالدين، سواء في 70S، وأعراض، كان طبيعيا تماما. وأكد تسلسل الإكسونات اثنين في كل من الآباء والأمهات أن الأم قامت بحذف 9 غليان في اكسون 11 والد طفرة مغلطة في اكسون 15. وفي هذه الحالة، 1450-1458del9 يعمل بشكل واضح بطريقة مقهورة مع مزيج من اثنين الطفرات متخالف المطلوبة لإنتاج النمط الظاهري المرض. لم استبدال F676L لا تحدث في مجال وظيفي واضح داخل paraplegin. أنه يؤدي إلى إحلال يسين للفينيل ألانين، ولم يتم الكشف عن هذا التغيير في 200 الكروموسومات السيطرة، ودعم دورها بوصفها الطفرة المسببة للأمراض.
فشل التحليل النسيجي للعضلات من اثنين من المرضى الذين يعانون من الطفرات SPG7 لإظهار التغيرات المورفولوجية عنها سابقا مرتبطة بضعف الفسفرة التأكسدية، على الرغم من كل ما زالوا متنقل وأقل تضررا من الحالات السابقة. غياب هذه الميزات على خزعة العضلات وبالتالي لا يمكن أن تستبعد SPG7 كسبب للمرض. وتمثلت النتيجة متسقة الوحيد من التغييرات إزالة التعصيب مع وجود فائض من نوع الألياف I مما يعكس على الأرجح منذ فترة طويلة التشنج.
الميتوكوندريا الأنشطة السلسلة التنفسية في العضلات من المرضى 2 و 3، ومع ذلك، أظهرت انخفاضا في مجمع الأول ومجمع النشاط II / III مقارنة مع الضوابط، وعندما تصحيح لسينسيز سترات. وتم الحصول على نتائج مماثلة عند مقارنة مع المرضى الآخرين مع ARHSP ومنهم من قد استبعدت الطفرات SPG7، مما يشير إلى أن هذا التأثير قد لا تعكس ببساطة تأثير على العضلات من التشنج منذ فترة طويلة وقلة الحركة. ولكن نظرا لقلة عدد المرضى غير SPG7 ARHSP، والاختلافات بين المجموعتين لم تصل دلالة إحصائية.
وشملت دراسة سابقة من سلسلة وظيفة الجهاز التنفسي في العضلات من المرضى HSP اثنين من المرضى الذين يعانون من ARHSP، ومنهم من تم استبعاد طفرات SPG7 (بيمونتي وآخرون، 2001). كان واحدا من هذه التغيرات النسيجية مميزة مرتبطة بضعف الفسفرة التأكسدية، وسواء كانت معزولة أوجه القصور I المعقدة. أظهرت دراسة حديثة من وظيفة الميتوكوندريا في المرضى الذين يعانون HSP ومنهم على حد سواء SPG4 وSPG7 الطفرات قد استبعدت أيضا انخفاضا في كل من الأنشطة IV I ومعقدة تعقيدا (ماكديرموت وآخرون، 2003)، مما يوحي بأن العيوب السلسلة التنفسية قد يكون أمرا شائعا أكثر من شكل واحد من ARHSP.
نمط معقد نقص I-III في العضلات والهيكل العظمي مماثلة لتلك التي وجدت في أنسجة القلب من المرضى الذين يعانون من ترنح فريدريك (برادلي وآخرون، 2000). في رنح فريدريك، ويعتقد أن نقص frataxin أن يؤدي إلى تشكيل كتلة الحديد الكبريت غير طبيعي في سلسلة بروتينات الجهاز التنفسي، مما يؤدي إلى الإجهاد التأكسدي والتلف. ويعتبر هذا النمط من نقص معقدة I-III أيضا في الماوس SOD2 خروج المغلوب (Melov وآخرون، 1999). ولذلك فمن الممكن أن نمط التنفس سلسلة خلل في العضلات من المرضى الذين يعانون من الطفرات SPG7 قد تمثل ضرر الجذور الحرة بوساطة الزائد. حقيقة أنه ليس هناك سوى خلل في النشاط I معقدة وقد لوحظ في myoblasts قد تمثل مجرد تراكم الضرر التأكسدي في ثابت بدلا من تقسيم الأنسجة.
تظهر الطفرات SPG7 أن يكون سبب نادر نسبيا من HSP، التي تم تحديدها في ثلاث فقط من أصل 49 (6٪) من المرضى دراستها. هذا الرقم، ومع ذلك، ينبغي اعتبار الحد الأدنى للتقدير كما SSCP قد فشلت في الكشف عن الطفرات. بالإضافة إلى ذلك، يوضح هذه الدراسة أيضا أن مركز SPG7 هو متعدد الأشكال للغاية. SSCP ليس أداة فعالة لفحص للطفرات، والتسلسل المباشر هو الأفضل.
وباختصار، فقد حددت هذه الدراسة ستة الطفرات في ثلاث حالات جديدة من SPG7 HSP. تم العثور على التغيرات البيوكيميائية، ولكن ليس النسيجية في عينات العضلات، مشيرا إلى أن معيار خزعة العضلات تلطيخ ليس اختبار تشخيصي مفيدة. وجود ترنح مع HSP، حتى في حالة متفرقة، يجب تنبيه الطبيب إلى إمكانية حدوث طفرات SPG7 كسبب.
المرضية الكامنة التي تنطوي على ضعف الميتوكوندريا قد تجعل هذه الحالات أكثر قابلية للتدخلات العلاجية من الأشكال الأخرى للمرض. هناك حاجة لدراسات إضافية لتحديد وظيفة محددة من paraplegin في الميتوكوندريا الإنسان في الصحة والمرض من أجل تسهيل تطوير علاجات محتملة المعدلة للمرض لهذا النوع من HSP.

رافت ابراهيم 11-22-2015 09:54 PM

طيف spg4 الطفرات في مجموعة كبيرة من الأسر أمريكا الشمالية وراثي مشلول الشلل النصفي
 
http://archneur.jamanetwork.com/arti...ticleid=781440


الساعة الآن 07:06 AM.

Powered by vBulletin® Version 3.8.2
Copyright ©2000 - 2019, Jelsoft Enterprises Ltd

a.d - i.s.s.w